G10446 (amy2a,LOC107700520,LOC107594668,LOC105896008)


Basic Information

Item Value
gene id G10446
gene name amy2a,LOC107700520,LOC107594668,LOC105896008
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056700.1
NCBI id CM032069.1
chromosome length 25613461
location 9057090 ~ 9057859 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU15557
CTGGCGTCCCAGAATGTGACAATAGATGCACCTCCAGCACCATGTCCTCTCTGGTTATCATGGTTGTCCACAAACACCAGAGCTTTATCAGAAGCCATGAAGCCCCAACCCTCACCCCAGTTTCTGAAATTGACATAGGACAGTTTTTCTCCATTCCATTTGCGAATGATATTGCCCAGCTTGGCACCATACTTGAACTCAGTCACTCTTCCAATTCCAGTATATTCACCCGATGTAATGGGCTCCCCACC

Function

symbol description
amy2a Predicted to enable alpha-amylase activity; alpha-amylase activity (releasing maltohexaose); and metal ion binding activity. Predicted to act upstream of or within carbohydrate metabolic process. Is expressed in pancreas. Orthologous to several human genes including AMY2A (amylase alpha 2A).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU15557 True 251 lncRNA 0.48 2 9057090 9057859

Neighbor

gene id symbol gene type direction distance location
vav3b vav3b,LOC107700567,LOC107732951,LOC107677852,LOC107553269 coding upstream 127780 8890773 ~ 8929310 (+)
LOC122359011 arhgef4,LOC107700563,LOC107710620,LOC107553266,LOC107732940 coding upstream 178990 8848327 ~ 8878100 (+)
LOC122361595 LOC107710620 coding upstream 215356 8830820 ~ 8841734 (+)
amer3 LOC107710619,LOC107700565,LOC107677756,LOC107732953,LOC107553265,LOC107569737 coding upstream 394767 8651917 ~ 8662323 (+)
atr atr,LOC107677746,LOC107700496 coding upstream 405544 8630412 ~ 8651546 (+)
col11a1b col11a1b,LOC107680048,LOC107594685,LOC107710593,LOC107564536,LOC107700498,LOC107745694 coding downstream 29835 9087694 ~ 9154434 (+)
tecrl2b tecrl2b,LOC107564537,LOC107745691 coding downstream 115994 9173853 ~ 9180307 (+)
abcd3b abcd3b,abcd3,LOC107564533,LOC107730494,LOC107680052,LOC106590647 coding downstream 181773 9239632 ~ 9248291 (+)
si:dkey-10f21.4 tmem56,si:dkey-10f21.4,LOC107710631,LOC107730492,LOC107570488 coding downstream 197526 9255385 ~ 9277476 (+)
LOC122324815 hccsa.1,LOC107594665,LOC107710606,LOC107700523 coding downstream 219904 9277763 ~ 9281294 (+)
G10445 NA non-coding upstream 845 9055723 ~ 9056245 (+)
G10433 NA non-coding upstream 115904 8939969 ~ 8941186 (+)
G10431 NA non-coding upstream 127017 8929504 ~ 8930073 (+)
G10374 NA non-coding upstream 176637 8879942 ~ 8880453 (+)
G10371 NA non-coding upstream 258094 8798591 ~ 8798996 (+)
G10466 NA non-coding downstream 157646 9215505 ~ 9216664 (+)
G10557 NA non-coding downstream 396507 9454366 ~ 9454745 (+)
G10571 NA non-coding downstream 428318 9486177 ~ 9572793 (+)
G10581 LOC107722512,LOC107693701,LOC107594678 non-coding downstream 519312 9577171 ~ 9577406 (+)
G10604 NA non-coding downstream 544507 9602366 ~ 9603843 (+)
G10212 NA other upstream 949313 8106865 ~ 8107777 (+)
G10108 NA other upstream 1474705 7504622 ~ 7582385 (+)
gng12a gng12a,LOC107700509,LOC107716954,LOC107551713 other upstream 1756989 7285670 ~ 7300101 (+)
lrrc53 LOC107700485,LOC107588905,LOC107716924 other upstream 1951298 7098303 ~ 7105792 (+)
G9925 LOC107563058,LOC107549254 other upstream 2069971 6986298 ~ 6987119 (+)
olfm3b olfm3b,LOC107700521,LOC107710604,LOC107745696,LOC107680049 other downstream 104752 9162611 ~ 9171915 (+)
arpc5a arpc5a,arpc5,LOC107722639,LOC107693740,LOC107564704,LOC107677751,LOC107718183 other downstream 688711 9746570 ~ 9751212 (+)
znf414 LOC107722538,LOC107564712,LOC107693731,LOC107691619,LOC107718126 other downstream 853769 9911628 ~ 9916861 (+)
selenof selenof,sep15,LOC107693704,LOC106598901 other downstream 1100673 10158532 ~ 10161809 (+)
lyrm4 lyrm4,LOC107718092,LOC107688446,LOC107722638,LOC107689406,LOC107688520 other downstream 1604870 10662729 ~ 10665110 (+)

Expression


Co-expression Network