G334



Basic Information


Item Value
gene id G334
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 617513 ~ 617792 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU407
GGGAGAACCTGTTTGATGTTCTTATTGGAACGGAAGAGTGGTGTTTTCCGCGGCTAGGCCGCCTCATCGTTACCCAAGTGCCCTGCTGCGCGGGCTCTACAGCCGGAACCGAACAATGTACAGAGTTCACTAAGCTAGTCGCATCCAAAACAGTATCTGAAGCCCTTACATTCTTACTATCCTCAATTAAAGTTTGGATGTGTGTCTCTAATTCTGAGATTTTCTCTGTCAGCCTGACTATTTCTCTACATTTATGACATGTAAATCCCTCGTCGCTGAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU407 True 280 lncRNA 0.37 1 617513 617792

Neighbor


gene id symbol gene type direction distance location
CI01000000_00588173_00605818 NA coding upstream 11317 587868 ~ 606196 (+)
CI01000000_00264365_00265448 NA coding upstream 352007 264365 ~ 265506 (+)
CI01000000_00260299_00262433 NA coding upstream 353989 260299 ~ 263524 (+)
CI01000000_00252240_00259416 SPON2B, SPON2 coding upstream 357665 252240 ~ 259848 (+)
CI01000000_00127682_00128077 NA coding upstream 489436 123554 ~ 128077 (+)
CI01000000_00639336_00658655 NA coding downstream 21360 639152 ~ 659048 (+)
CI01000000_00678887_00679319 NA coding downstream 60920 678712 ~ 680447 (+)
CI01000000_00753279_00782484 PPP3CA, PPP3CB coding downstream 135487 753279 ~ 782484 (+)
CI01000000_00814932_00820795 NA coding downstream 197140 814932 ~ 820875 (+)
CI01000000_00825374_00827067 NA coding downstream 207453 825245 ~ 827766 (+)
G333 NA non-coding upstream 188 617046 ~ 617325 (+)
G330 NA non-coding upstream 6971 610342 ~ 610542 (+)
G318 NA non-coding upstream 43204 574063 ~ 574309 (+)
G317 NA non-coding upstream 44115 573092 ~ 573398 (+)
G316 NA non-coding upstream 44559 572537 ~ 572954 (+)
G336 NA non-coding downstream 9817 627609 ~ 627873 (+)
G339 NA non-coding downstream 22103 639895 ~ 640185 (+)
G344 NA non-coding downstream 27752 645544 ~ 645774 (+)
G243 NA non-coding downstream 28933 646725 ~ 691607 (+)
G252 NA other upstream 110441 503209 ~ 507072 (+)
G350 NA other downstream 54050 671842 ~ 676937 (+)
G435 NA other downstream 807329 1425121 ~ 1432854 (+)
G579 NA other downstream 1197661 1767917 ~ 1908808 (+)
G2774 NA other downstream 3835986 4453778 ~ 4454232 (+)
G2850 NA other downstream 4108194 4725986 ~ 4726482 (+)

Expression



Co-expression Network