G10869 (selenof,sep15,LOC107693704,LOC107586130)


Basic Information

Item Value
gene id G10869
gene name selenof,sep15,LOC107693704,LOC107586130
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056700.1
NCBI id CM032069.1
chromosome length 25613461
location 10158578 ~ 10160064 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU16144
CTCACCTTCCTAGACTCCAGCTGAGCCTCCTCTTGGCAGCACTGCCTGCAGGGAAGGTCTAACTGGCCCAGGCTGAACTGACCCAGGAGATCACAGGAGCTGCACAGGAGATTGCTGGAGAAGCCCATCTCCCTGCAGGCCTCAGAGGAGAGCTCCGCTCCATAAGATGCCGTTTGTAATAACGGCAGTAACCAAAGCAGGTACACCTCCCCCGCCATCAGTGTTTC

Function

symbol description
selenof Predicted to enable oxidoreductase activity and selenium binding activity. Predicted to be located in endoplasmic reticulum. Predicted to be active in endoplasmic reticulum lumen. Is expressed in several structures, including axis; mesoderm; otic placode; pectoral fin bud; and pectoral fin musculature. Orthologous to human SELENOF (selenoprotein F).

NR:

description
PREDICTED: 15 kDa selenoprotein-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU16144 True 227 lncRNA 0.51 2 10158578 10160064

Neighbor

gene id symbol gene type direction distance location
hs2st1a hs2st1a,hs2st1,LOC107718112,LOC107589844,LOC107691454,LOC107722647,LOC107585633,LOC106598897 coding downstream 557 10146582 ~ 10158021 (-)
lrrc8da lrrc8d,lrrc8da,LOC107722644,LOC107585666,LOC107718115,LOC107691468,LOC107589846,LOC107722505 coding downstream 44993 10108131 ~ 10113585 (-)
sept2 sept2,LOC107722571,LOC107693718 coding downstream 87115 10062763 ~ 10071463 (-)
bokb bokb,LOC107693720,LOC107722584 coding downstream 105135 10049401 ~ 10053443 (-)
zgc:161973 LOC107722582,LOC107693721,LOC107718160,LOC107585707 coding downstream 112698 10040661 ~ 10045880 (-)
tox tox,LOC107718108,LOC107722616,LOC107585594 coding upstream 63267 10223331 ~ 11062973 (-)
trnak-cuu_1 NA coding upstream 229487 10389551 ~ 10389623 (-)
LOC122359424 mplkip,LOC107722562,LOC107585495,LOC107688429,LOC107718104,LOC107689394,LOC107589834 coding upstream 269730 10429794 ~ 10433121 (-)
inhbab inhbab,LOC107718177,LOC107589832 coding upstream 305245 10465309 ~ 10476229 (-)
afg3l2 afg3l2,LOC107589831,LOC107689395,LOC107688430,LOC107585478,LOC108435493 coding upstream 321606 10481670 ~ 10489280 (-)
G10812 NA non-coding downstream 111205 10046818 ~ 10047373 (-)
G10773 NA non-coding downstream 230741 9926105 ~ 9927837 (-)
G10708 NA non-coding downstream 409838 9748387 ~ 9748740 (-)
G10621 NA non-coding downstream 552383 9605638 ~ 9606195 (-)
G10562 NA non-coding downstream 697494 9457163 ~ 9461084 (-)
G10987 NA non-coding upstream 66154 10226218 ~ 10226856 (-)
G11057 NA non-coding upstream 506413 10666477 ~ 10666712 (-)
G11064 rpp40,LOC107722637,LOC107688445,LOC107689405 non-coding upstream 507578 10667642 ~ 10668967 (-)
G11063 rpp40,LOC107688445,LOC107722637,LOC107689405 non-coding upstream 508998 10669062 ~ 10669414 (-)
G11097 NA non-coding upstream 585971 10746035 ~ 10817620 (-)
lmo4 LOC107722609,LOC107693715,LOC107691760,LOC107589910 other downstream 14869 10140935 ~ 10143709 (-)
pkn2a pkn2,LOC107693716,LOC107585639,LOC107722607,LOC107718113,LOC107691687 other downstream 18993 10119973 ~ 10139585 (-)
hfm1 hfm1,LOC107722645,LOC107586144 other downstream 62721 10080182 ~ 10095857 (-)
si:ch211-267e7.3 si:ch211-267e7.3,LOC107722581,LOC107594654,LOC107718186,LOC107589917,LOC107677774,LOC107693699 other downstream 540105 9606323 ~ 9618473 (-)
plppr5a plppr5,plppr5a,LOC107722655,LOC107693754,LOC107677753,LOC107589876,LOC108441579,LOC107718169 other downstream 638797 9491563 ~ 9519781 (-)
ca8 ca8,LOC107693711,LOC107585586,LOC107691405,LOC107589840,LOC107722503,LOC102778484 other upstream 153969 10314033 ~ 10320403 (-)
G11011 chd7,LOC107585562,LOC107722533,LOC107688517,LOC107718105,LOC107589837,LOC107689390 other upstream 215999 10376063 ~ 10378211 (-)
fbxl7 fbxl7,LOC107718179,LOC107689422,LOC107688519,LOC107589836,LOC107722558,LOC107585539 other upstream 232618 10392682 ~ 10421475 (-)
G11102 tgfbr1a,LOC107585257,LOC107722631,LOC107688454,LOC107689415,LOC107718081 other upstream 597964 10758028 ~ 10764891 (-)
LOC122359216 tgfbr1a,LOC107688454,LOC107585257,LOC107722631,LOC107589809,LOC107718081,LOC107689415 other upstream 607910 10767974 ~ 10861595 (-)

Expression


Co-expression Network