G454


Basic Information

Item Value
gene id G454
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 924486 ~ 924704 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU550
AAGTGATACTACCTTACAGAAGAACAAGTCTATCTGGACCAATAAAAGAAGATGAAGTGTGCCTTTAGAAGAATCTTCACTAGAAGAAAAATGCTAGATGCCACTCCAAAGTGGAAATTTCCAATGAAGTCAAAATTATAGAAGAATTAATTGAATTTTCCACTTTCTTCTACGTTATAACCCTAGTGTACAGTTTTTGTCAGGGGTGTAGGAACGAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU550 True 219 lncRNA 0.38 1 924486 924704

Neighbor

gene id symbol gene type direction distance location
CI01000000_00825374_00827067 NA coding upstream 96720 825245 ~ 827766 (+)
CI01000000_00814932_00820795 NA coding upstream 103611 814932 ~ 820875 (+)
CI01000000_00753279_00782484 PPP3CA, PPP3CB coding upstream 142002 753279 ~ 782484 (+)
CI01000000_00678887_00679319 NA coding upstream 244039 678712 ~ 680447 (+)
CI01000000_00639336_00658655 NA coding upstream 265438 639152 ~ 659048 (+)
CI01000000_00948279_00956688 NA coding downstream 23575 948279 ~ 957335 (+)
CI01000000_00977418_00984766 TRAPPC11, TRAPPC11.S coding downstream 52714 977418 ~ 984766 (+)
CI01000000_01005677_01006063 NA coding downstream 80696 1005400 ~ 1006589 (+)
CI01000000_01061972_01081591 STOX2A, STOX2B, STOX2 coding downstream 135943 1060647 ~ 1082636 (+)
CI01000000_01100131_01102607 NA coding downstream 175427 1100131 ~ 1102724 (+)
G412 NA non-coding upstream 31853 892401 ~ 892633 (+)
G408 NA non-coding upstream 45717 878478 ~ 878769 (+)
G399 NA non-coding upstream 66971 857315 ~ 857515 (+)
G396 NA non-coding upstream 72207 851759 ~ 852279 (+)
G243 NA non-coding upstream 232879 646725 ~ 691607 (+)
G455 NA non-coding downstream 768 925472 ~ 925690 (+)
G457 NA non-coding downstream 14264 938968 ~ 939656 (+)
G465 NA non-coding downstream 77552 1002256 ~ 1002595 (+)
G424 NA non-coding downstream 165089 1089793 ~ 1098771 (+)
CI01000000_01105760_01112812 NA non-coding downstream 188105 1105760 ~ 1113952 (+)
G350 NA other upstream 247549 671842 ~ 676937 (+)
G252 NA other upstream 417414 503209 ~ 507072 (+)
G435 NA other downstream 500417 1425121 ~ 1432854 (+)
G579 NA other downstream 890749 1767917 ~ 1908808 (+)
G2774 NA other downstream 3529074 4453778 ~ 4454232 (+)
G2850 NA other downstream 3801282 4725986 ~ 4726482 (+)
G6811 NA other downstream 9280127 10204831 ~ 10321679 (+)

Expression


Co-expression Network