G479


Basic Information

Item Value
gene id G479
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 1248550 ~ 1248813 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU576
ATTCATATAGGTGCCTATGGGGCAAAACTGTATTGTGGTAAAAATAGTTCAGTTTTATGACCCAAAATTCTCATTTATTTCCCTAATGTAAGCAATCCTACTTGTTTTTGTGAGTAAAACCATTTACTGTACGTAAATCTCACTGGGTTCGAGCCCTTTTGTTTTATTATGCACCTGTGGAAGTTTATAGAAATCTGCTCCAAGGAAAGAGAGCAAAGCCGAAAGCTTTCAAAAGTCACTCGTGCAGTATACCTGGAAGGAGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU576 True 264 lncRNA 0.34 1 1248550 1248813

Neighbor

gene id symbol gene type direction distance location
CI01000000_01209256_01229839 NA coding upstream 18191 1208489 ~ 1230359 (+)
CI01000000_01196208_01208022 CLK4, CLK4A coding upstream 40193 1196208 ~ 1208357 (+)
CI01000000_01176488_01180221 4EB3L, 4EBP, EIF4EBP3, EIF4EBP3L coding upstream 68281 1176450 ~ 1180269 (+)
CI01000000_01149697_01163047 RUFY1 coding upstream 84570 1149697 ~ 1163980 (+)
CI01000000_01105760_01112812 NA coding upstream 134598 1105760 ~ 1113952 (+)
CI01000000_01347674_01352321 NA coding downstream 98861 1347674 ~ 1353228 (+)
CI01000000_01405606_01410241 NIPSNAP3A coding downstream 156793 1405606 ~ 1410503 (+)
CI01000000_01459294_01485147 SLC44A1 coding downstream 210481 1459294 ~ 1485311 (+)
CI01000000_01511690_01517631 IKBKAP coding downstream 262877 1511690 ~ 1517719 (+)
CI01000000_01680507_01690297 CPLX2, CPLX1, CPLX1.L coding downstream 431694 1680507 ~ 1691194 (+)
G473 NA non-coding upstream 26033 1222293 ~ 1222517 (+)
G416 NA non-coding upstream 53235 1190949 ~ 1195315 (+)
G446 NA non-coding upstream 75195 1171527 ~ 1173355 (+)
G466 NA non-coding upstream 131198 1117115 ~ 1117352 (+)
G480 NA non-coding downstream 3983 1252796 ~ 1253069 (+)
G483 NA non-coding downstream 6227 1255040 ~ 1255303 (+)
G499 NA non-coding downstream 55044 1303857 ~ 1304057 (+)
G449 NA non-coding downstream 113230 1362043 ~ 1363359 (+)
G502 NA non-coding downstream 118314 1367127 ~ 1367360 (+)
G350 NA other upstream 571613 671842 ~ 676937 (+)
G252 NA other upstream 741478 503209 ~ 507072 (+)
G435 NA other downstream 176308 1425121 ~ 1432854 (+)
G579 NA other downstream 566640 1767917 ~ 1908808 (+)
G2774 NA other downstream 3204965 4453778 ~ 4454232 (+)
G2850 NA other downstream 3477173 4725986 ~ 4726482 (+)
G6811 NA other downstream 8956018 10204831 ~ 10321679 (+)

Expression


Co-expression Network