rps8a (rps8a,rps8,LOC107674081,LOC107688507,LOC107602544)


Basic Information

Item Value
gene id rps8a
gene name rps8a,rps8,LOC107674081,LOC107688507,LOC107602544
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056700.1
NCBI id CM032069.1
chromosome length 25613461
location 12278732 ~ 12281207 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043219222.1
GCCAGAACAACTACTCTCGCGATTTCTCCAGGTATTGTCGCGATAAGTGGTTGCTTGAAACCCGCCCATGAGCCTTTGCGAGCCCTCTTTCTAGCCGGCGCCTGAGAATGGGTATCTCAAGGGACAACTGGCACAAACGCCGCAAGACTGGTGGCAAGCGCAAGCCCGTCCACAAGAAAAGGAAATATGAGCTTGGGCGTCCTCCCGCGAACACAAAGATTGGACCTCGCCGCATCCACACAATAAGAGTCCGTGGTGGAAACAAGAAATACCGTGCTTTGAGGCTCGATGTGGGAAATTTCTCTTGGGGCTCAGAATGCTGTACCCGCAAGACTAGGATCATTGATGTGGTCTACAATGCCTCTAACAATGAGCTGGTGAGAACCAAGACCCTGGTGAAGAACTGCGTTGTCCTTGTGGACAGCAATCCCTACAGACAGTGGTACGAGTCTCACTACGCTCTTCCACTTGGCAGGAAGAAGGGTGCCAAGCTGACCCCTGAAGAAGAGGAAATCCTGAACAAGAAGAGGTCAAAGAAGGTCCAAAAGAAGTTTGATAAGCGCAGAAAGAACAGCAAAATCAGTCCTCTGCTGGAGGAGCAGTTTCTGCAGGGGAAACTTCTTGCCTGCATTGCCTCCAGACCAGGACAGTGTGGCAGGGCTGATGGCTACGTCCTTGAGGGCAAAGAACTGGAGTTTTACCTGAGGAAGATTAAAGCCAAGAAAGGCAAATAAATGTACAGCTCTCTTTGATACGACCATTAAAGAAAATACCCCAACTCA

Function

symbol description
rps8a Predicted to be a structural constituent of ribosome. Acts upstream of or within chordate embryonic development and regulation of cell cycle. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Orthologous to human RPS8 (ribosomal protein S8).
rps8 A structural constituent of ribosome. Predicted to be involved in maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA). Located in cytosolic ribosome and endoplasmic reticulum. Part of cytosolic small ribosomal subunit.

NR:

description
unnamed protein product, partial

GO:

id name namespace
GO:0051726 regulation of cell cycle biological_process
GO:0006414 translational elongation biological_process
GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) biological_process
GO:0009790 embryo development biological_process
GO:0022627 cytosolic small ribosomal subunit cellular_component
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
K02995 RP-S8e, RPS8; small subunit ribosomal protein S8e

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043219222.1 True 782 mRNA 0.50 6 12278732 12281207

Neighbor

gene id symbol gene type direction distance location
hectd3 hectd3,LOC107688506,LOC107674075 coding upstream 665 12270887 ~ 12278067 (+)
efna2a efna2a,LOC107688504,LOC107729478,LOC107584867,LOC107602547,LOC107732508,LOC107674409 coding upstream 21845 12204405 ~ 12256887 (+)
ptbp1a ptbp1a,LOC107602545,LOC107732511,LOC107674042,LOC107584874 coding upstream 77587 12191229 ~ 12201145 (+)
palm1b LOC107729325,LOC107688502,LOC107584893,LOC107674018,LOC107732516 coding upstream 88796 12176228 ~ 12189936 (+)
plppr3a plppr3a,LOC107584910,LOC107729344,LOC107688501,LOC107732518,LOC107674011,LOC107602549 coding upstream 109815 12156094 ~ 12168917 (+)
LOC122328950 NA coding downstream 165 12281372 ~ 12281504 (+)
lrrc42 LOC107729432,LOC107586495,LOC107602539,LOC107688527,LOC107682545 coding downstream 52580 12333787 ~ 12336926 (+)
ttpa ttpa,LOC107688513,LOC107729218,LOC107584770,LOC107674130,LOC107602535 coding downstream 74681 12355888 ~ 12359062 (+)
asph asph,LOC107729161,LOC107584723,LOC107688512,LOC107714857,LOC107602531 coding downstream 80513 12361720 ~ 12376736 (+)
LOC122360148 LOC108278063 coding downstream 88542 12369749 ~ 12371452 (+)
G11419 NA non-coding upstream 177606 12100875 ~ 12101126 (+)
G11207 LOC107688485,LOC107585026,LOC107550612,LOC107709892,LOC107722651 non-coding upstream 659869 11614241 ~ 11618863 (+)
LOC122328936 NA non-coding upstream 665166 11609251 ~ 11613566 (+)
G11191 NA non-coding upstream 821868 11456326 ~ 11456864 (+)
G11190 NA non-coding upstream 823324 11454258 ~ 11455408 (+)
G11505 NA non-coding downstream 56460 12337667 ~ 12339049 (+)
G11590 NA non-coding downstream 264146 12545353 ~ 12545592 (+)
G11593 NA non-coding downstream 333168 12614375 ~ 12614596 (+)
G11595 dsela,LOC107679326,LOC107584692,LOC107728919,LOC107714854,LOC107674195 non-coding downstream 334788 12615995 ~ 12621414 (+)
G11618 NA non-coding downstream 415879 12697086 ~ 12697294 (+)
pld1a pld1a,LOC107688495,LOC107550602,LOC107680234,LOC107722545,LOC108442335 other upstream 341142 11908073 ~ 11937590 (+)
mast3a LOC107722547,LOC107688474,LOC107680242,LOC107550619,LOC107709878,LOC107586070 other upstream 771028 11482104 ~ 11507704 (+)
rps28 NA other upstream 834161 11422090 ~ 11444571 (+)
mrpl34 LOC107688463,LOC107585198,LOC107722555,LOC107680228 other upstream 937621 11339735 ~ 11341111 (+)
fitm1l LOC107589905,LOC107718171,LOC107585187,LOC107688462,LOC107722554 other upstream 940263 11303678 ~ 11338469 (+)
LOC122358236 NA other downstream 342616 12623823 ~ 12626387 (+)
rnf152 rnf152,LOC107729101,LOC107679332,LOC107567413,LOC107674343,LOC107714840,LOC107584540 other downstream 586722 12867929 ~ 12874008 (+)
G11854 jph1b,jph1,LOC107584332,LOC107550709,LOC107746914,LOC107732545,LOC107664083,LOC107686034,LOC107740042 other downstream 1894157 14175364 ~ 14179615 (+)
plxdc2a LOC107686089,LOC107713976,LOC107751571 other downstream 2464900 14746107 ~ 14753161 (+)
ackr4a LOC107664061,LOC107751559,LOC107556724,LOC107751558,LOC107751560,LOC107713978,LOC107586293 other downstream 2495115 14776322 ~ 14782977 (+)

Expression


Co-expression Network