G480


Basic Information

Item Value
gene id G480
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 1252796 ~ 1253069 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU577
TCCTACTGATATGTCACTTGCATAATAATTTGGAACACAGTGTACTTTATGAATAATGTACAAATTAAATAATATGCCTAGTTCTATCATGAAACTCTAGATGGCGCAGGCTGATAGGTCTCAGCGTTAACTACTTGGACAAACTGATTGGTTCATGTCACATTTGCAGCCAATGAGCTTGCTGCTCACAACATTTAAATGGCTGTTTGGCATTCACTGTAGCAGTTTGCAGCACACTTTCAGAATTCCTCTGAAACCCTCCACCTTCCCCAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU577 True 274 lncRNA 0.36 1 1252796 1253069

Neighbor

gene id symbol gene type direction distance location
CI01000000_01209256_01229839 NA coding upstream 22437 1208489 ~ 1230359 (+)
CI01000000_01196208_01208022 CLK4, CLK4A coding upstream 44439 1196208 ~ 1208357 (+)
CI01000000_01176488_01180221 4EB3L, 4EBP, EIF4EBP3, EIF4EBP3L coding upstream 72527 1176450 ~ 1180269 (+)
CI01000000_01149697_01163047 RUFY1 coding upstream 88816 1149697 ~ 1163980 (+)
CI01000000_01105760_01112812 NA coding upstream 138844 1105760 ~ 1113952 (+)
CI01000000_01347674_01352321 NA coding downstream 94605 1347674 ~ 1353228 (+)
CI01000000_01405606_01410241 NIPSNAP3A coding downstream 152537 1405606 ~ 1410503 (+)
CI01000000_01459294_01485147 SLC44A1 coding downstream 206225 1459294 ~ 1485311 (+)
CI01000000_01511690_01517631 IKBKAP coding downstream 258621 1511690 ~ 1517719 (+)
CI01000000_01680507_01690297 CPLX2, CPLX1, CPLX1.L coding downstream 427438 1680507 ~ 1691194 (+)
G479 NA non-coding upstream 3983 1248550 ~ 1248813 (+)
G473 NA non-coding upstream 30279 1222293 ~ 1222517 (+)
G416 NA non-coding upstream 57481 1190949 ~ 1195315 (+)
G446 NA non-coding upstream 79441 1171527 ~ 1173355 (+)
G466 NA non-coding upstream 135444 1117115 ~ 1117352 (+)
G483 NA non-coding downstream 1971 1255040 ~ 1255303 (+)
G499 NA non-coding downstream 50788 1303857 ~ 1304057 (+)
G449 NA non-coding downstream 108974 1362043 ~ 1363359 (+)
G502 NA non-coding downstream 114058 1367127 ~ 1367360 (+)
G506 NA non-coding downstream 115266 1368335 ~ 1368897 (+)
G350 NA other upstream 575859 671842 ~ 676937 (+)
G252 NA other upstream 745724 503209 ~ 507072 (+)
G435 NA other downstream 172052 1425121 ~ 1432854 (+)
G579 NA other downstream 562384 1767917 ~ 1908808 (+)
G2774 NA other downstream 3200709 4453778 ~ 4454232 (+)
G2850 NA other downstream 3472917 4725986 ~ 4726482 (+)
G6811 NA other downstream 8951762 10204831 ~ 10321679 (+)

Expression


Co-expression Network