G499



Basic Information


Item Value
gene id G499
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 1303857 ~ 1304057 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU597
GGATCCCTATCCTCTCCTCTTGCAATCTTCTTCTTATGCTGTTTAATAAGATAAAGTCCCACTTATAAACTTACTTGAGACTGAGTATCGCCCTCTATAGTCTTAGGTAATCAGAAAATACTACACAATCAAGCATTTTTTATCAATGAACAACTGAAGTGGCTGCAAAGCTAAATGGATACATTAAGATTACCATACCCG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU597 True 201 lncRNA 0.39 1 1303857 1304057

Neighbor


gene id symbol gene type direction distance location
CI01000000_01209256_01229839 NA coding upstream 73498 1208489 ~ 1230359 (+)
CI01000000_01196208_01208022 CLK4, CLK4A coding upstream 95500 1196208 ~ 1208357 (+)
CI01000000_01176488_01180221 4EB3L, 4EBP, EIF4EBP3, EIF4EBP3L coding upstream 123588 1176450 ~ 1180269 (+)
CI01000000_01149697_01163047 RUFY1 coding upstream 139877 1149697 ~ 1163980 (+)
CI01000000_01105760_01112812 NA coding upstream 189905 1105760 ~ 1113952 (+)
CI01000000_01347674_01352321 NA coding downstream 43617 1347674 ~ 1353228 (+)
CI01000000_01405606_01410241 NIPSNAP3A coding downstream 101549 1405606 ~ 1410503 (+)
CI01000000_01459294_01485147 SLC44A1 coding downstream 155237 1459294 ~ 1485311 (+)
CI01000000_01511690_01517631 IKBKAP coding downstream 207633 1511690 ~ 1517719 (+)
CI01000000_01680507_01690297 CPLX2, CPLX1, CPLX1.L coding downstream 376450 1680507 ~ 1691194 (+)
G483 NA non-coding upstream 48554 1255040 ~ 1255303 (+)
G480 NA non-coding upstream 50788 1252796 ~ 1253069 (+)
G479 NA non-coding upstream 55044 1248550 ~ 1248813 (+)
G473 NA non-coding upstream 81340 1222293 ~ 1222517 (+)
G416 NA non-coding upstream 108542 1190949 ~ 1195315 (+)
G449 NA non-coding downstream 57986 1362043 ~ 1363359 (+)
G502 NA non-coding downstream 63070 1367127 ~ 1367360 (+)
G506 NA non-coding downstream 64278 1368335 ~ 1368897 (+)
G505 NA non-coding downstream 68062 1372119 ~ 1374608 (+)
G504 NA non-coding downstream 71956 1376013 ~ 1376769 (+)
G350 NA other upstream 626920 671842 ~ 676937 (+)
G252 NA other upstream 796785 503209 ~ 507072 (+)
G435 NA other downstream 121064 1425121 ~ 1432854 (+)
G579 NA other downstream 511396 1767917 ~ 1908808 (+)
G2774 NA other downstream 3149721 4453778 ~ 4454232 (+)
G2850 NA other downstream 3421929 4725986 ~ 4726482 (+)
G6811 NA other downstream 8900774 10204831 ~ 10321679 (+)

Expression



Co-expression Network