G710


Basic Information

Item Value
gene id G710
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 2023761 ~ 2023971 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU822
ATTTCAAGGGATTTGTTCACCAAAATTTAAATGCTGTCTAGTTTGCCTTATTCCAAACTTGTGGAAAAAACATTTTTCCTTTTCTGTATAAAGCAAGGCTAAGTGAATTTATTGACCACTACTTTCCTGTCTACTACTCAACAATTACATATATTTTATATCTTATACCTTAAAACTGTGTTTTCTTCAATCAGAGGAATCAACATTTCAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU822 True 211 lncRNA 0.46 1 2023761 2023971

Neighbor

gene id symbol gene type direction distance location
CI01000000_01996254_01997531 GPR151 coding upstream 26144 1996074 ~ 1997617 (+)
CI01000000_01978179_01992602 PPP2R2BB, PPP2R2B, PPP2R2B.L coding upstream 30800 1978179 ~ 1992961 (+)
CI01000000_01916310_01925119 NA coding upstream 98371 1916052 ~ 1925390 (+)
CI01000000_01899373_01901550 TSTD2 coding upstream 122079 1899373 ~ 1901682 (+)
CI01000000_01898604_01899281 NA coding upstream 124480 1898042 ~ 1899281 (+)
CI01000000_02080057_02086228 REST coding downstream 55860 2079831 ~ 2087510 (+)
CI01000000_02092375_02096188 POLR2B.L, RPB2, POLR2B coding downstream 68322 2092293 ~ 2096188 (+)
CI01000000_02237986_02243555 NA coding downstream 213723 2237694 ~ 2243820 (+)
CI01000000_02334112_02352906 NA coding downstream 309584 2333555 ~ 2353369 (+)
CI01000000_02496792_02498535 NA coding downstream 472773 2496744 ~ 2498594 (+)
G700 NA non-coding upstream 104197 1919256 ~ 1919564 (+)
G699 NA non-coding upstream 104819 1918732 ~ 1918942 (+)
G579 NA non-coding upstream 115602 1767917 ~ 1908808 (+)
G645 NA non-coding upstream 180593 1842322 ~ 1843168 (+)
G593 NA non-coding upstream 289372 1733247 ~ 1734389 (+)
G717 NA non-coding downstream 14062 2038033 ~ 2038258 (+)
G718 NA non-coding downstream 14506 2038477 ~ 2038716 (+)
G719 NA non-coding downstream 14886 2038857 ~ 2039092 (+)
G721 NA non-coding downstream 16393 2040364 ~ 2040732 (+)
G1323 NA non-coding downstream 135715 2159686 ~ 2160082 (+)
G435 NA other upstream 590907 1425121 ~ 1432854 (+)
G350 NA other upstream 1346824 671842 ~ 676937 (+)
G252 NA other upstream 1516689 503209 ~ 507072 (+)
G2774 NA other downstream 2429807 4453778 ~ 4454232 (+)
G2850 NA other downstream 2702015 4725986 ~ 4726482 (+)
G6811 NA other downstream 8180860 10204831 ~ 10321679 (+)
G6820 NA other downstream 8403252 10427223 ~ 10433018 (+)
G7018 NA other downstream 8954518 10978489 ~ 10980872 (+)

Expression


Co-expression Network