LOC122328985


Basic Information

Item Value
gene id LOC122328985
gene name NA
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056700.1
NCBI id CM032069.1
chromosome length 25613461
location 1383708 ~ 1383784 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XR_006247871.1
GTATGAAATGATGGTATACCATCTTTCGGGACTGACCTCTCATGGAGAGATTTGTTTCTAAACATAACTGATCGTAC

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_006247871.1 True 77 snoRNA 0.39 1 1383708 1383784
Loading

Neighbor

gene id symbol gene type direction distance location
kcnmb2 kcnmb2,LOC107656859,LOC107568625 coding downstream 35941 1345142 ~ 1347767 (-)
pcolce2a pcolce2a,LOC107681764,LOC107599838,LOC107709043,LOC107565816 coding downstream 110553 1264644 ~ 1273155 (-)
chst2a chst2a,LOC107681814,LOC107599839,LOC107656863,LOC107722292 coding downstream 136446 1245074 ~ 1247262 (-)
fubp1 fubp1,LOC107681766,LOC107703234 coding downstream 368322 1006589 ~ 1015386 (-)
usp33 usp33,LOC107708728,LOC107751869,LOC107681685 coding downstream 387960 974125 ~ 995748 (-)
LOC122328960 NA coding upstream 306 1384090 ~ 1384275 (-)
LOC122328955 NA coding upstream 913 1384697 ~ 1384875 (-)
LOC122328981 NA coding upstream 1313 1385097 ~ 1385166 (-)
wu:fc46h12 NA coding upstream 25085 1408869 ~ 1413253 (-)
LOC122323714 LOC107715522,LOC107681815,LOC108437516,LOC108267691,LOC105889505 coding upstream 31561 1415345 ~ 1425295 (-)
G8443 NA non-coding downstream 50604 1332845 ~ 1333104 (-)
G8439 LOC107722542 non-coding downstream 73417 1309945 ~ 1310291 (-)
G8415 NA non-coding downstream 135118 1248176 ~ 1248590 (-)
G8386 NA non-coding downstream 336801 1046590 ~ 1046907 (-)
G8385 NA non-coding downstream 340758 1042745 ~ 1042950 (-)
G8479 NA non-coding upstream 15624 1399408 ~ 1399728 (-)
G8489 LOC107696015,LOC107710542,LOC107721879 non-coding upstream 78276 1462060 ~ 1462514 (-)
G8599 NA non-coding upstream 456388 1840172 ~ 1876938 (-)
G8623 ppm1la,ppm1l,LOC107681725,LOC107722109,LOC107701333,LOC101065476,LOC106534897 non-coding upstream 539500 1923284 ~ 1929991 (-)
G8622 ppm1l,LOC107560765,LOC107722109,LOC107681725,LOC107701312,LOC107701333 non-coding upstream 546840 1930624 ~ 1932631 (-)
mfsd8l2 si:ch211-38m6.6,LOC107681768,LOC107656858,LOC107565819,LOC107722537,LOC107599859,LOC108437504,LOC105026921 other downstream 45710 1331430 ~ 1337998 (-)
dipk2aa dia1a,LOC107681802,LOC107599840,LOC107722302,LOC107565821,LOC108437525,LOC108268022 other downstream 180721 1179945 ~ 1202987 (-)
LOC122325167 NA other downstream 779764 119350 ~ 603944 (-)
colgalt2a LOC107593860,LOC107681694,LOC107715500 other upstream 141964 1525748 ~ 1532557 (-)
gng5 NA other upstream 538511 1922295 ~ 1940721 (-)
slc1a7a slc1a7a,slc1a7,LOC107722044,LOC107671767,LOC107681716,LOC107593788 other upstream 632624 2016408 ~ 2038705 (-)
tmem125b tmem125b,LOC107719275,LOC107681700,LOC107681734,LOC107719290,LOC107593887 other upstream 666646 2050430 ~ 2055709 (-)
LOC122355284 NA other upstream 691514 2075298 ~ 2128540 (-)

Expression

LOC122328985 Expression in all Baseline Samples

Bar chart with 10 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

LOC122328985 Expression in each Bioproject

Bar chart with 1 bar.
LOC122328985 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network