G85074 (psmc5,LOC107684752,LOC103381410,LOC107753303)


Basic Information

Item Value
gene id G85074
gene name psmc5,LOC107684752,LOC103381410,LOC107753303
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056710.1
NCBI id CM032079.1
chromosome length 20499150
location 2582799 ~ 2583328 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU126056
TGATGTTCTTTGTGGCCTCAAACCCATCCAGCTGGTTGAGGAGCTCCAGCATAGTTCTCTGCACTTCACTGTCTCCTCCTGATCCCCCTTCCAAACGAGATGAGCCGATGGAGTCGATCTCATCCATGAAGATGATGGAGGGCGCGTGTTCCCTGGCCATGACGAACAGCTCTCGCACCATACGAGCTCCTCTCCTATGAATTTCTGCACCAGCTCTGATCCAGACACCCTGATGAAGGTACAGTCGGTGTGATGGGCCACGGCTCTGGCTAACAGGGTCTTTCCTGTTCCAGGAGGTCCATAGAGCAACACACCCTGCAGACCGACACATCACAGAATATGAAGTGGAT

Function

symbol description
psmc5 Predicted to enable TBP-class protein binding activity and thyrotropin-releasing hormone receptor binding activity. Predicted to be involved in modulation of chemical synaptic transmission; positive regulation of RNA polymerase II transcription preinitiation complex assembly; and proteasome-mediated ubiquitin-dependent protein catabolic process. Predicted to act upstream of or within protein catabolic process. Predicted to be located in cytoplasm and nucleus. Predicted to be part of cytosolic proteasome complex; nuclear proteasome complex; and proteasome regulatory particle, base subcomplex. Predicted to be active in postsynapse. Orthologous to human PSMC5 (proteasome 26S subunit, ATPase 5).

NR:

description
PREDICTED: 26S protease regulatory subunit 8

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU126056 True 350 lncRNA 0.53 2 2582799 2583328

Neighbor

gene id symbol gene type direction distance location
mpp2b mpp2b,LOC107684751,LOC107569196,LOC107694069,LOC107753302 coding upstream 5897 2545758 ~ 2576902 (+)
pyyb pyyb,LOC107695522,LOC107745683,LOC107569181,LOC107753323,LOC107684781,LOC107560546 coding upstream 37680 2542386 ~ 2545119 (+)
tut1 LOC107684771,LOC107695563,LOC107560560,LOC107753301 coding upstream 49981 2528102 ~ 2532818 (+)
ndc80 ndc80,LOC107684779,LOC107569179,LOC107560547,LOC107695521,LOC107753322,LOC107745668 coding upstream 55651 2520345 ~ 2527148 (+)
mki67 LOC107695561,LOC107560541 coding upstream 63329 2509777 ~ 2519470 (+)
ngfrb ngfrb,LOC107745659,LOC107684756,LOC107569198,LOC107560558,LOC107694076,LOC107753306 coding downstream 37876 2621204 ~ 2650285 (+)
LOC122355797 ccdc6a,LOC107717103,LOC107663299,LOC107671115,LOC107733539,LOC108431652,LOC105910584,LOC105010545 coding downstream 203515 2786843 ~ 2797453 (+)
atoh1c LOC107598046,LOC107745660,LOC107660485,LOC107678425,LOC107716449,LOC107571691 coding downstream 912961 3496289 ~ 3497041 (+)
LOC122355621 htra1,htra1b,LOC107660481,LOC107745581,LOC107598034,LOC106578991 coding downstream 1007264 3590592 ~ 3616744 (+)
LOC122355747 htra1,htra1b,LOC107660481,LOC107745581,LOC107598034,LOC106578991 coding downstream 1109783 3693111 ~ 3720271 (+)
G85051 NA non-coding upstream 197017 2385239 ~ 2385782 (+)
G85041 NA non-coding upstream 199908 2381697 ~ 2382891 (+)
G84975 LOC107654065,LOC107745648,LOC107739059 non-coding upstream 388484 2191169 ~ 2194315 (+)
G84969 LOC107593513,LOC107654065,LOC107745648 non-coding upstream 395238 2185843 ~ 2187561 (+)
G84960 NA non-coding upstream 577634 2004913 ~ 2005165 (+)
G85097 NA non-coding downstream 21768 2605096 ~ 2606217 (+)
G85213 NA non-coding downstream 95386 2678714 ~ 2679294 (+)
G85215 NA non-coding downstream 96716 2680044 ~ 2680317 (+)
G85248 LOC107581964,LOC107732308,LOC107692781,LOC107697371,LOC107587198,LOC107707128 non-coding downstream 285835 2869163 ~ 2871748 (+)
G85332 NA non-coding downstream 1177974 3761302 ~ 3788868 (+)
G84866 ank3,LOC107746453,LOC107654059 other upstream 750808 1820519 ~ 1831991 (+)
bicc1b bicc1,LOC107653928,LOC107596591 other upstream 853369 1659828 ~ 1729430 (+)
si:ch211-131k2.2 NA other upstream 1599009 981423 ~ 983790 (+)
G84731 dlx4b,LOC107739765,LOC107708902,LOC107664616 other upstream 1685264 891599 ~ 897535 (+)
G84422 LOC107708886 other upstream 2167487 394346 ~ 415312 (+)
LOC122355862 ank3a,LOC107663296,LOC107733536,LOC107717054,LOC107654059,LOC107727055,LOC107746453,LOC107695539 other downstream 132312 2715640 ~ 2783970 (+)
LOC122355426 rhobtb1,LOC107654062,LOC107727061,LOC107695540,LOC107552568,LOC107746840,LOC107718339,LOC107680668,LOC107676653 other downstream 218284 2801612 ~ 2820613 (+)
LOC122355768 waplb,wapl,LOC107598042,LOC107660482,LOC107716480,LOC107745560,LOC107678383,LOC107571690,LOC105006405 other downstream 590861 3174189 ~ 3211352 (+)
btbd16 btbd16,LOC107660483,LOC107716451,LOC107598041 other downstream 671390 3254718 ~ 3267839 (+)
ndufa4b ndufa4,ndua4,LOC107745684,LOC107569184,LOC107684782,LOC103023526,LOC108443163 other downstream 1692012 4275340 ~ 4277385 (+)

Expression


Co-expression Network