G86202


Basic Information

Item Value
gene id G86202
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056710.1
NCBI id CM032079.1
chromosome length 20499150
location 7387668 ~ 7388981 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU127574
actggaacactgggaaacgtcccacgttctagtgaacagggacgtgcggaagtccagccttcccgtaggaggtctcggaacgaatacgcatatggacagtatttcagtttgcatatggaaaattggaggtgattgaaccctcttagacgggcagaaggtctgccggggaaacacggggctctaaggctatgccgtggaaatacacacataaagtcctcttggggtactttacatggctcccagccctcaccggttctcacggattcatcgagagggcctggcgccggatgctccgcaacatctggctgccgaggggaatggaggagctcgacagggtctactgtatggacgctctggagaggttaacaagccgacccgaaaccgggcctctcagtgtttctacccgtttgaggtgagaacacaggaggataccggttccactcgtaggctatagaatctagcaatcgagttgggggtcgcccagcccgcagctctacaatctgtcagcgaggtgccacgagccaccgcccaggacgatgcaacacttgctgagtgtgcccgcaacctgaggggggggcagggcataccctgtgcttggtaggctagggtaatggcgtccactatccagtgagccatcctctgcttggaggcggcactccccttctgccggcctctgtgacaaacgagagctggactgaggtcctgaagctttgtgtccggtcaacgtagcatcttagtgctcggacgggacaagcaacgtcagggctgggtctgcctcctccaggggcagcgcttgaaggttcaccacctggtctctgaagggggtagtgggaaccttgggcacgtagccgggccgtggcctcagtggtacctgggaatccgcgagcccaaactgtaggcacgaatcgtcgaccgaaaaagcctgcaggtcccctaccctcttgatggaggccaatgcgagcaggagcaaatgtcttcatagataaaagaactttagcacaactgctggcaagggttcaacggagcctactgcagtgctgtcagcactacagacaggtcccaagagggtactgttgggagccgtggaggattcaacctcctggcttccctcaggaacctgataatccggccatgcttacccacagacctcccatctatggggtcatgatttgcagcgattgcagccacatagactttaagggtggagggagacagccttcgctccaacccttgctgcaagaagataagcacgactgatagggcaattccgggggtcttcaccctgagaagaacaccactcgacgaacaggctct

Function

GO:

id name namespace
GO:0002253 activation of immune response biological_process
GO:0006955 immune response biological_process
GO:0048584 positive regulation of response to stimulus biological_process
GO:0002376 immune system process biological_process
GO:0002682 regulation of immune system process biological_process
GO:0002684 positive regulation of immune system process biological_process
GO:0050776 regulation of immune response biological_process
GO:0050778 positive regulation of immune response biological_process

KEGG:

id description
ko05150 Staphylococcus aureus infection
ko05140 Leishmaniasis

RNA

RNA id representative length rna type GC content exon number start site end site
TU127574 True 1314 lncRNA 0.57 1 7387668 7388981

Neighbor

gene id symbol gene type direction distance location
muc13b NA coding upstream 1705 7378927 ~ 7385963 (+)
znf281b LOC107727698,LOC107584153,LOC107661093,LOC107594149 coding upstream 12863 7366334 ~ 7374805 (+)
svild LOC107758427,LOC107675649,LOC107561632 coding upstream 95528 7233938 ~ 7292140 (+)
nmt1b LOC107561637,LOC107662571,LOC107758416 coding upstream 154019 7225862 ~ 7233649 (+)
plcd3b plcd3b,LOC107751666,LOC107561636,LOC107662566 coding upstream 168224 7183430 ~ 7219444 (+)
lrp2b LOC107753462,LOC107669174,LOC107584197 coding downstream 14571 7403552 ~ 7472715 (+)
mpp3b mpp3b,LOC107669230,LOC107594152,LOC107584156,LOC107753440 coding downstream 84742 7473723 ~ 7486698 (+)
ppp1r3cb ppp1r3cb,LOC107584161,LOC107753441,LOC107758435,LOC107704020,LOC107594153,LOC107669176 coding downstream 98739 7487720 ~ 7492825 (+)
ankrd1b ankrd1b,LOC107584237,LOC107669173,LOC107753461 coding downstream 160023 7549004 ~ 7552494 (+)
kif20bb kif20bb,LOC107669226,LOC107753438,LOC107584147 coding downstream 166032 7555013 ~ 7566171 (+)
LOC122355189 NA non-coding upstream 68077 7317500 ~ 7319591 (+)
G86141 NA non-coding upstream 89634 7297683 ~ 7298034 (+)
G86140 NA non-coding upstream 90125 7297318 ~ 7297543 (+)
G86131 NA non-coding upstream 165713 7221528 ~ 7221955 (+)
G86110 hexim1,LOC107733802,LOC107661096,LOC107662567,LOC107561639,LOC107751667,LOC107576140 non-coding upstream 214339 7129610 ~ 7173329 (+)
G86219 NA non-coding downstream 113597 7502578 ~ 7504499 (+)
G86275 NA non-coding downstream 312362 7701343 ~ 7701799 (+)
G86283 NA non-coding downstream 330003 7718984 ~ 7719283 (+)
G86268 NA non-coding downstream 331411 7720392 ~ 7723861 (+)
G86374 NA non-coding downstream 457577 7846558 ~ 7846862 (+)
G86143 NA other upstream 79439 7307924 ~ 7308229 (+)
G86142 NA other upstream 82820 7303138 ~ 7304848 (+)
G86029 NA other upstream 865097 6521829 ~ 6522571 (+)
G86019 LOC107570179 other upstream 946142 6440821 ~ 6441526 (+)
G85986 adprh,LOC108411014,LOC107726130,LOC105894051,LOC108274007 other upstream 1171101 6214919 ~ 6216567 (+)
LOC122355675 NA other downstream 426842 7815823 ~ 7844083 (+)
msrb1b msrb1b,LOC100705913 other downstream 716167 8105148 ~ 8106780 (+)
hbbe2 hbbe2,LOC107734191,LOC105910203 other downstream 806983 8195964 ~ 8197904 (+)
arsg arsg,LOC107734203,LOC107660857,LOC107692046,LOC107554066 other downstream 1447467 8836448 ~ 8852449 (+)
pkd1b LOC107723630,LOC107665861,LOC107556563 other downstream 1896682 9285663 ~ 9306831 (+)

Expression


Co-expression Network