G86848 (gna13a,LOC107660858,LOC107584085,LOC107734232,LOC107554062,LOC107692049)


Basic Information

Item Value
gene id G86848
gene name gna13a,LOC107660858,LOC107584085,LOC107734232,LOC107554062,LOC107692049
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056710.1
NCBI id CM032079.1
chromosome length 20499150
location 8821880 ~ 8823436 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU128502
CTGAAACTCTCTCCGTCTGTCATAAGCATTCTGAATGCCACTGTCTTGCCACAGGGCACGGATGGAGGGCAGGTAGTTGAGAAAGACTTTAGTCTCCATCATCCCTTTGGCCATCAAGGATGAGCGGGTGTCAAAGGCCATCACTGCCTCCCCGTGAGCCTGATTGTCAGGATCTCCCCAAGGGATGTGCAGCTTCTCACGGGCATCCACAAGCACTCGGATACCTGTACCTTTGATAACATTGCTGTAGATCGTAGCCCGGATCTCCTCTTTGGCCCGCTGATCGAAGTCCTGCCCATGAATTATGCGCATTTGTTTGAGGAAAGTTGACTTGCCACTTTCGCCTGCTCCTAACAGCAAAATCTTCACCAGCTTCTTCGCGTAAGTTTTCTCTCGAGACAGGCTTTTATCGATCGCCCTAGACTTTCTAATTTGGTCAATTTCGCCGCTGGAGAGAAGACAATTGGGAACACAAACTATAGCAGTCCGGGAGAGCAGGAAATCCGCCATCTTTGTAGTAACGACTTCATG

Function

symbol description
gna13a Enables cadherin binding activity. Acts upstream of or within several processes, including endocardial progenitor cell migration to the midline involved in heart field formation; gastrulation; and glial cell development. Predicted to be part of heterotrimeric G-protein complex. Predicted to be active in brush border membrane. Is expressed in brain; gill; head; and olfactory epithelium. Orthologous to human GNA13 (G protein subunit alpha 13).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU128502 True 531 lncRNA 0.50 2 8821880 8823436

Neighbor

gene id symbol gene type direction distance location
rgs9b rgs9b,LOC107660859,LOC107584086,LOC107734240,LOC107692097,LOC107709642,LOC108444257,LOC107554020 coding downstream 818 8809082 ~ 8821062 (-)
mrtfab LOC107692050,LOC107734192,LOC107660860,LOC107584087,LOC107709647 coding downstream 13240 8781679 ~ 8808640 (-)
xrcc6 xrcc6,LOC107734244,LOC107584091,LOC107709651,LOC107554059 coding downstream 78274 8738942 ~ 8743606 (-)
josd1 josd1,LOC107660868,LOC107554019 coding downstream 83632 8733817 ~ 8738248 (-)
cbx7b LOC107660863,LOC107734182,LOC107584093,LOC107554058,LOC107692056,LOC107709653 coding downstream 88891 8728809 ~ 8732989 (-)
LOC122355256 slc16a6a,LOC107554067,LOC107721990,LOC107692048 coding upstream 8646 8832082 ~ 8837257 (-)
snx11 snx11,LOC107734201,LOC107584079,LOC107660856,LOC106589286 coding upstream 21675 8845111 ~ 8852234 (-)
snf8 snf8,LOC107554070,LOC107692042,LOC107734219,LOC107584075,LOC107660854 coding upstream 46629 8870065 ~ 8872539 (-)
nme2a nme2a,LOC107574626,LOC107558983,LOC107660852,LOC107734222 coding upstream 119675 8943111 ~ 8946818 (-)
eme1 eme1,LOC107584393,LOC107723632,LOC107705828 coding upstream 450929 9274365 ~ 9281289 (-)
G86825 NA non-coding downstream 74803 8675646 ~ 8747077 (-)
G86826 NA non-coding downstream 77235 8680105 ~ 8744645 (-)
G86809 LOC107731413,LOC107584098,LOC107734194,LOC107663181 non-coding downstream 191673 8627094 ~ 8630207 (-)
G86798 NA non-coding downstream 192908 8597394 ~ 8628972 (-)
G86807 NA non-coding downstream 195551 8623297 ~ 8626329 (-)
G86852 arsg,LOC107734203,LOC107660857 non-coding upstream 14915 8838351 ~ 8838612 (-)
G86853 NA non-coding upstream 17378 8840814 ~ 8841155 (-)
G86854 arsg,LOC107734203,LOC107660857,LOC107554066,LOC107692046 non-coding upstream 19951 8843387 ~ 8843774 (-)
G86856 NA non-coding upstream 29509 8852945 ~ 8853257 (-)
G86857 NA non-coding upstream 31893 8855329 ~ 8855541 (-)
trnar-ccu_66 NA other downstream 134310 8687498 ~ 8687570 (-)
plbd1b LOC107578697 other downstream 134332 8682443 ~ 8687548 (-)
G86783 cby1,LOC107554026,LOC107734186,LOC107584208,LOC107690074 other downstream 209435 8610552 ~ 8612445 (-)
LOC122355061 tnfrsf17,LOC107554040,LOC107692075,LOC107690067,LOC107584106,LOC107734209 other downstream 308615 8511403 ~ 8513265 (-)
cpped1 cpped1,LOC107584109,LOC107669238,LOC107554009 other downstream 461888 8334404 ~ 8359992 (-)
LOC122355288 LOC107660874 other upstream 52181 8875617 ~ 8878131 (-)
thrab thrab,LOC107584392,LOC107733455,LOC107657272,LOC108430158,LOC107665883,LOC107723634 other upstream 488217 9311653 ~ 9939849 (-)
ormdl3 ormdl3,LOC107723636,LOC107657273,LOC107556587,LOC108273759,LOC102217224,LOC106521946,LOC102783025,LOC105936292,LOC107092838 other upstream 658123 9481559 ~ 9489312 (-)
cript cript,LOC107582781,LOC107728714 other upstream 2181570 11005006 ~ 11006954 (-)
LOC122355648 cox7a3,LOC107550034,LOC107582778,LOC107749383,LOC107728726,LOC108429329,LOC108273985,LOC107700119 other upstream 2219452 11042888 ~ 11045889 (-)

Expression


Co-expression Network