G87406 (fshr,LOC107728706,LOC107582855,LOC107673646)


Basic Information

Item Value
gene id G87406
gene name fshr,LOC107728706,LOC107582855,LOC107673646
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056710.1
NCBI id CM032079.1
chromosome length 20499150
location 10895841 ~ 10896147 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU129351
AGTCTATGCCGTAGTTGTAGTAGTGGGACTGTGTCTGAAAGTCCTTGATGGCGATGATCAACAGGTAAATGCCCATGCAAAGGTCCGCGAAAGCCAGGTGGCACATTAGAAACCTGGGAACAGTCAGTTTGTAGCGGCTCGTGAGAAGCACCAGGAGGACTGCACAGTTGCCCACGATGGCCAATATGCTGATGAACCAGATCAGAACACGCAGGAATGTAAAACCCATGATGTCCTCGCAGGGGTTGAATGCATCTGGTCTGGGGTAGCAGGTCACTTCTATTACATCTTTGCAGTGCTCGTCAAA

Function

symbol description
fshr Enables follicle-stimulating hormone receptor activity. Acts upstream of or within male gonad development; ovarian follicle development; and spermatogenesis. Predicted to be located in basolateral plasma membrane. Predicted to be integral component of membrane. Predicted to be integral component of plasma membrane. Is expressed in Leydig cell; female organism; gonad; and kidney. Human ortholog(s) of this gene implicated in 46 XX gonadal dysgenesis; ovarian dysgenesis 1; and ovarian hyperstimulation syndrome. Orthologous to human FSHR (follicle stimulating hormone receptor).

NR:

description
PREDICTED: follicle-stimulating hormone receptor-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU129351 True 307 lncRNA 0.50 1 10895841 10896147

Neighbor

gene id symbol gene type direction distance location
chac2 chac2,LOC107749368,LOC107686371 coding downstream 282339 10610648 ~ 10613502 (-)
LOC122355804 nrg3b,LOC107566665,LOC107573948,LOC107678479,LOC107689960 coding downstream 751112 10138438 ~ 10144729 (-)
LOC122355287 fam20cb,fam20c,LOC107734234,LOC107699871,LOC107669229,LOC107731385,LOC108432010 coding downstream 1090331 9788025 ~ 9805510 (-)
LOC122355272 cpped1,LOC107584109,LOC107669238,LOC107554009 coding downstream 1139794 9743392 ~ 9756047 (-)
LOC122355289 ercc4,LOC107734247,LOC107669240,LOC107692079 coding downstream 1155313 9734537 ~ 9740528 (-)
foxn2b LOC107698833,LOC107749364,LOC107550040,LOC107582787,LOC107728721,LOC107673647 coding upstream 4106 10900253 ~ 10915884 (-)
fbxo11b fbxo11b,fbxo11,LOC107728720,LOC107582786,LOC107550041,LOC107673644,LOC107698831,LOC108430631 coding upstream 22632 10918779 ~ 10931157 (-)
msh2 msh2,LOC107698830,LOC107582784,LOC107749362,LOC107550043,LOC107728724,LOC107673650 coding upstream 35715 10931862 ~ 10938013 (-)
socs5a LOC107582782,LOC107728716,LOC107698827,LOC107673648,LOC107550046,LOC107749358,LOC107550045 coding upstream 88895 10985042 ~ 10996581 (-)
rhoq rhoq,LOC107550049,LOC107582780 coding upstream 116325 11012472 ~ 11027430 (-)
LOC122355137 NA non-coding downstream 1124 10868848 ~ 10894717 (-)
G87376 NA non-coding downstream 31245 10816561 ~ 10864596 (-)
G87388 NA non-coding downstream 91103 10793063 ~ 10804738 (-)
G87164 NA non-coding downstream 289822 10605232 ~ 10606019 (-)
G87125 svila,svil,LOC107584371 non-coding downstream 313305 10578754 ~ 10582536 (-)
G87429 mta3,LOC107749351,LOC105904126 non-coding upstream 175102 11071249 ~ 11071765 (-)
G87449 NA non-coding upstream 212749 11108896 ~ 11165039 (-)
G87450 NA non-coding upstream 228300 11124447 ~ 11126279 (-)
G87409 NA non-coding upstream 362870 11259017 ~ 11298534 (-)
G87482 NA non-coding upstream 375594 11271741 ~ 11273302 (-)
thrab thrab,LOC107584392,LOC107733455,LOC107657272,LOC108430158,LOC107665883,LOC107723634 other downstream 955992 9311653 ~ 9939849 (-)
ormdl3 ormdl3,LOC107723636,LOC107657273,LOC107556587,LOC108273759,LOC102217224,LOC106521946,LOC102783025,LOC105936292,LOC107092838 other downstream 1406529 9481559 ~ 9489312 (-)
LOC122355288 LOC107660874 other downstream 2017710 8875617 ~ 8878131 (-)
trnar-ccu_66 NA other downstream 2208271 8687498 ~ 8687570 (-)
plbd1b LOC107578697 other downstream 2208293 8682443 ~ 8687548 (-)
cript cript,LOC107582781,LOC107728714 other upstream 108859 11005006 ~ 11006954 (-)
LOC122355648 cox7a3,LOC107550034,LOC107582778,LOC107749383,LOC107728726,LOC108429329,LOC108273985,LOC107700119 other upstream 146741 11042888 ~ 11045889 (-)
G87489 NA other upstream 425276 11321423 ~ 11322603 (-)
G87569 NA other upstream 936732 11832879 ~ 11835612 (-)
G87608 NA other upstream 1052393 11948540 ~ 11951155 (-)

Expression


Co-expression Network