LOC122355287 (fam20cb,fam20c,LOC107734234,LOC107699871,LOC107669229,LOC107731385,LOC108432010)


Basic Information

Item Value
gene id LOC122355287
gene name fam20cb,fam20c,LOC107734234,LOC107699871,LOC107669229,LOC107731385,LOC108432010
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056710.1
NCBI id CM032079.1
chromosome length 20499150
location 9788025 ~ 9805510 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043253390.1
GATGTCCTCAGACTCCTATCCAAATTGGCTCCGCTTCCACATTGGGATCAACCGGTATGAGCTTTACTCCAGGCACAACCCGGTCATAGATGCAATGCTGAAGGATCTGGTGTCGCAGAGAATTACCAGCGTTGCGATGAAATCTGGAGGCACGCAGCTGAAGCTCATCATGACATTCCAGAACTATGGCCAAGCGCTCTTCAAGCCCATGAAAGGGATATCACTGCCTTCAATGACCATCCCCTCTGGAGAGGTTTTTTCTTCAGCGTCCCACTCGTCCGCGTCTCGCTGTCTTTCTGCCCTCACGCTGCGCTCTGGCCTCGGATCCTGTCCATTAAGCTGTTTCCAGCAGCTCTGTAATATGAAGGAATGGAGTGCCCTCGGCACCCTGACATTCTGACTGTGTCATCATTAACCTGCCCGTCTGTGTATCTGCCCTCCGCGGGGCTTGCGTTTGCTGCATGGCTGAGGCGAGCGCTGGAATG

Function

symbol description
fam20cb Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in enamel mineralization and protein phosphorylation. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to colocalize with Golgi apparatus. Human ortholog(s) of this gene implicated in amelogenesis imperfecta. Orthologous to human FAM20C (FAM20C golgi associated secretory pathway kinase).
fam20c Enables manganese ion binding activity and protein serine/threonine kinase activity. Involved in biomineral tissue development and protein phosphorylation. Located in Golgi apparatus and extracellular space. Implicated in amelogenesis imperfecta. Biomarker of X-linked dominant hypophosphatemic rickets.

NR:

description
PREDICTED: extracellular serine/threonine protein kinase FAM20C-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043253390.1 True 485 mRNA 0.54 3 9788025 9805510

Neighbor

gene id symbol gene type direction distance location
LOC122355272 cpped1,LOC107584109,LOC107669238,LOC107554009 coding downstream 31978 9743392 ~ 9756047 (-)
LOC122355289 ercc4,LOC107734247,LOC107669240,LOC107692079 coding downstream 47497 9734537 ~ 9740528 (-)
LOC122355243 LOC107734216,LOC107669223,LOC107584111,LOC107692080,LOC107554034 coding downstream 53685 9713064 ~ 9734340 (-)
zcchc4 zcchc4,LOC107657290,LOC107733462,LOC107738986 coding downstream 116745 9662758 ~ 9671280 (-)
zbtb4 LOC107733450,LOC107657284,LOC107584385,LOC107738964,LOC107556580,LOC107665872 coding downstream 172484 9601511 ~ 9615541 (-)
LOC122355804 nrg3b,LOC107566665,LOC107573948,LOC107678479,LOC107689960 coding upstream 332928 10138438 ~ 10144729 (-)
chac2 chac2,LOC107749368,LOC107686371 coding upstream 805138 10610648 ~ 10613502 (-)
foxn2b LOC107698833,LOC107749364,LOC107550040,LOC107582787,LOC107728721,LOC107673647 coding upstream 1094743 10900253 ~ 10915884 (-)
fbxo11b fbxo11b,fbxo11,LOC107728720,LOC107582786,LOC107550041,LOC107673644,LOC107698831,LOC108430631 coding upstream 1113269 10918779 ~ 10931157 (-)
msh2 msh2,LOC107698830,LOC107582784,LOC107749362,LOC107550043,LOC107728724,LOC107673650 coding upstream 1126352 10931862 ~ 10938013 (-)
G87055 NA non-coding downstream 20787 9763102 ~ 9767238 (-)
G87034 NA non-coding downstream 152908 9632044 ~ 9635117 (-)
G87019 NA non-coding downstream 213500 9573634 ~ 9574525 (-)
G86916 NA non-coding downstream 488126 9299679 ~ 9299899 (-)
G86861 LOC107734218,LOC107660853,LOC107584076 non-coding downstream 918963 8867892 ~ 8869062 (-)
G87104 NA non-coding upstream 555367 10360877 ~ 10361414 (-)
LOC122355705 nrg3b,LOC107678479,LOC108426474,LOC107689960,LOC108273971,LOC107566665,LOC107387893 non-coding upstream 603829 10409339 ~ 10444778 (-)
G87125 svila,svil,LOC107584371 non-coding upstream 773244 10578754 ~ 10582536 (-)
G87164 NA non-coding upstream 799722 10605232 ~ 10606019 (-)
G87388 NA non-coding upstream 987553 10793063 ~ 10804738 (-)
ormdl3 ormdl3,LOC107723636,LOC107657273,LOC107556587,LOC108273759,LOC102217224,LOC106521946,LOC102783025,LOC105936292,LOC107092838 other downstream 298713 9481559 ~ 9489312 (-)
LOC122355288 LOC107660874 other downstream 909894 8875617 ~ 8878131 (-)
trnar-ccu_66 NA other downstream 1100455 8687498 ~ 8687570 (-)
plbd1b LOC107578697 other downstream 1100477 8682443 ~ 8687548 (-)
G86783 cby1,LOC107554026,LOC107734186,LOC107584208,LOC107690074 other downstream 1175580 8610552 ~ 8612445 (-)
cript cript,LOC107582781,LOC107728714 other upstream 1199496 11005006 ~ 11006954 (-)
LOC122355648 cox7a3,LOC107550034,LOC107582778,LOC107749383,LOC107728726,LOC108429329,LOC108273985,LOC107700119 other upstream 1237378 11042888 ~ 11045889 (-)
G87489 NA other upstream 1515913 11321423 ~ 11322603 (-)
G87569 NA other upstream 2027369 11832879 ~ 11835612 (-)
G87608 NA other upstream 2143030 11948540 ~ 11951155 (-)

Expression


Co-expression Network