crygmxl2 (crygmxl2,LOC107566855,LOC107708427,LOC107702435,LOC107581669,LOC107684145)


Basic Information

Item Value
gene id crygmxl2
gene name crygmxl2,LOC107566855,LOC107708427,LOC107702435,LOC107581669,LOC107684145
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056710.1
NCBI id CM032079.1
chromosome length 20499150
location 13555693 ~ 13557090 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043254237.1
CGTTTTCAAAGGTAAACTCTAGTTTCTGTGACGTGCCTCTGGCAGCAGTGTGTATACATCTGTAGAAGAGTATAAAAGGTCCACCAGGACCTCGATGGCAGTACGGCAGAACGGCGTGGACATCCTGCTCTGCAGCCATGGGAAAGATCATCTTCTACGAAGGCTCCAACTTCCAGGGGCGCTCTTATGAGTGCTCTGCTGACTGCACTGACACTTTTAGATACTTCAACTGCTGCAACTCCATACGGGTCATGGGGGGTCACTGGGTGGGCTACGAGAAGCCCTACTATATGGGGTATCAGTACATCCTGGGCCGTGGGGAGTATCCTAACTTTCACCACTGGATGGGCTTCAACAGTTGTATCAGATCTTGTCAGATGTTCCCCCCATACAGAGGTGCCTACCGCATGAGAATCTACAACAGACCTGAAATGTACGGAAACATGATGGAGTTCACAGATGACTGCCCCAATGTCTACGACCGTTTTGGCTACCACGGCATCTACTCCTGTAACTGTATGGAGGGCTACTGGTGCTTTTACGAGCACCCCAATTACAGAGGGCGTCAGTATTTCCTGCGGCCCGGAGAGTACAGAGCCTGCAGCGAATGGGGTTGCATGAATCCCATGATTGGCTCCTTTAGGAGAATGAGGAGCAGTTTAATGTAA

Function

symbol description
crygmxl2 Predicted to be a structural constituent of eye lens. Predicted to be involved in lens development in camera-type eye and visual perception. Is expressed in lens. Human ortholog(s) of this gene implicated in cataract; cataract 2 multiple types; cataract 39 multiple types; cataract 4 multiple types; and cataract 7. Orthologous to several human genes including CRYGA (crystallin gamma A); CRYGB (crystallin gamma B); and CRYGC (crystallin gamma C).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043254237.1 True 668 mRNA 0.51 3 13555693 13557090

Neighbor

gene id symbol gene type direction distance location
crygmx crygmx,LOC107755411,LOC107566847,LOC107684144,LOC107581668 coding downstream 668 13553556 ~ 13555025 (-)
casp7 casp7,LOC107707870,LOC107684033,LOC107581558,LOC107566160 coding downstream 110961 13436907 ~ 13444732 (-)
LOC122355076 LOC107566710,LOC107684141,LOC107581554 coding downstream 132735 13418717 ~ 13422958 (-)
LOC122355682 NA coding downstream 137437 13414181 ~ 13418256 (-)
plekhs1.1 LOC107566815,LOC107755416,LOC107702419 coding downstream 145412 13405793 ~ 13410281 (-)
vti1a vti1a,LOC107702459,LOC106589328,LOC107566351 coding upstream 162581 13719671 ~ 13839456 (-)
acsl5 acsl5,LOC107702457,LOC107566323,LOC107722228,LOC107755526,LOC107581566,LOC107684041 coding upstream 289083 13846173 ~ 13854773 (-)
tectb tectb,LOC107755437,LOC107702437,LOC107566341,LOC107581573,LOC107684045,LOC107722201 coding upstream 307736 13864826 ~ 13872555 (-)
nat9 LOC107702469,LOC107566461,LOC107581577,LOC107722187 coding upstream 443588 14000678 ~ 14003093 (-)
grin2cb grin2c,LOC107755516,LOC107702470,LOC107722186,LOC107684146,LOC107581635 coding upstream 486481 14043571 ~ 14081743 (-)
G88035 nrap,LOC107702452,LOC107755535 non-coding downstream 94448 13460145 ~ 13461245 (-)
G88034 nrap,LOC107755535,LOC107702452 non-coding downstream 95828 13458456 ~ 13459865 (-)
G88019 NA non-coding downstream 121568 13433894 ~ 13434125 (-)
G88003 NA non-coding downstream 187373 13365953 ~ 13368320 (-)
G87860 gabrz,LOC108273489,LOC107675029,LOC107754081,LOC107565977 non-coding downstream 748047 12804696 ~ 12807646 (-)
LOC122355666 NA non-coding upstream 151965 13709055 ~ 13712541 (-)
G88146 NA non-coding upstream 267510 13824600 ~ 13894358 (-)
G88205 NA non-coding upstream 436570 13993660 ~ 13994186 (-)
G88206 NA non-coding upstream 437282 13994372 ~ 13995952 (-)
G88233 NA non-coding upstream 574829 14131919 ~ 14133138 (-)
entpd1 LOC107707825,LOC107755533,LOC107581561,LOC107702455,LOC107684037,LOC107566185 other downstream 15392 13523668 ~ 13540301 (-)
LOC122355808 LOC107684141,LOC107702421,LOC107581556,LOC107684142,LOC107708119,LOC107708127 other downstream 123498 13424308 ~ 13432195 (-)
G87845 LOC107675011 other downstream 803015 12751904 ~ 12752678 (-)
prr15lb prr15lb,LOC107754107,LOC107675003,LOC107565730,LOC107743781,LOC107677864,LOC107563795 other downstream 880221 12649383 ~ 12675472 (-)
G87608 NA other downstream 1604538 11948540 ~ 11951155 (-)
tcf7l2 tcf7l2,LOC107755529,LOC107702422,LOC107750316,LOC107566231,LOC106949585,LOC106589326 other upstream 52330 13609420 ~ 13691340 (-)
srsf2a srsf2,LOC107702465,LOC107566380,LOC107684046 other upstream 415792 13972882 ~ 13976511 (-)
G88250 LOC107702476 other upstream 590957 14148047 ~ 14150005 (-)
G88365 NA other upstream 984476 14541566 ~ 14643780 (-)
LOC122355209 NA other upstream 1145478 14702568 ~ 14706251 (-)

Expression


Co-expression Network