LOC122355776 (grid1b,grid1,LOC106578986)


Basic Information

Item Value
gene id LOC122355776
gene name grid1b,grid1,LOC106578986
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056710.1
NCBI id CM032079.1
chromosome length 20499150
location 4701784 ~ 4827583 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043254334.1
ATGGTTGTGGTGAAGTACGTATTAAAGAGATTTCTGCGGCTCAAGCACCAGCCTGCTGTGATCCTTGAGGACACTGCTGAAGCATGTGAACTGATGACGCAGGGGATCCTGGCCTTGGTCACATCTACAGGCTGTGCCTCAGCCAGTGCTCTGCAGTCCCTGACAGATGCCATGCACATACCTCACCTTTACGTCCAGAGAAACGCCGAAGGATCACCTCGTACCGCATGTCAACTCAATCCAAGCCCAGACGGAGAGAGATACACCCTCGCATCGCGACCGCCCGTCCGTCTAAGTGATGTCATGTTGACGCTAGTTGGTGAGCTGCGTTGGCAGAAGTTCATCGTCTTCTATGACAGTGACTATGATATCCGTGGACTGCAAGTCTTTCTGGACCAGACATCAAGACAGGGTTTGGATGTGTCTCTGCAGCGAGTGGATAGGAACATCAGTGGCGTGTTTTCCAGTTTGTTCACCTCCATGCGCACAGAGGAGCTCAATCGCTACAGGGACACTCTCAGAAGAGCTATCTTGCTCTTGAGCCCTCGCGGAGCACAGGTCTTCATCAATCAGGCTGTGGAAACTAACCTGGCCTCTAAAGACAGTCACTGGGTGTTTGTGAATGAGGAGATCAGTGATACTGAGATTATGGAGCTAGCCCACAGTTCCTTGGGAAGGATGACGGTCGTCAGGCAGATTTTCCCTCTGTGGAAGGACAGCAGTGTGAGCTGTATGAGGAACAACCACCGCATCTCCTCATTGCTCTGTGACCCTCAGGAGGGCTACCTGCAGTCGCTGGAGGTGTCCAATTTGTACCTTTATGATAGTGTGTTGATGCTGGCTAATGCATTCTACCGGAAATTAGAAGATCGGAAGTGGCACAGTATGGCCAGCCTCAACTGCATCAGGAAGTCAACCAAGCCCTGGAACGGAGGCTGGTCCATGCTGGAAACGATCAAAAGGTACGATGTGTTTGATGTTAAGAATTTTTCAGAGCTGTCTGTCAAACTGATGGGGAGGGGCAGGCGGGGTGTCACATCTAGCATGCAAGACTAG

Function

symbol description
grid1b Predicted to enable glutamate receptor activity and transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential. Predicted to be involved in glutamatergic synaptic transmission and modulation of chemical synaptic transmission. Predicted to act upstream of or within ion transport. Predicted to be located in membrane and synapse. Predicted to be integral component of membrane. Predicted to be active in postsynaptic membrane. Orthologous to human GRID1 (glutamate ionotropic receptor delta type subunit 1).
grid1 Predicted to enable glutamate receptor activity; identical protein binding activity; and transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential. Predicted to be involved in glutamatergic synaptic transmission; modulation of chemical synaptic transmission; and social behavior. Located in extracellular exosome.

NR:

description
glutamate receptor ionotropic, delta-1 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043254334.1 True 1056 mRNA 0.51 6 4701784 4827583

Neighbor

gene id symbol gene type direction distance location
fam117ab LOC107569178,LOC107684758,LOC107745685,LOC107694066,LOC107753317 coding upstream 426819 4267987 ~ 4274965 (+)
rundc3ab rundc3ab,LOC107569197,LOC107694077,LOC107684757,LOC107753318 coding upstream 435978 4254314 ~ 4265806 (+)
pth3r pth1rb,LOC107753328,LOC107694067,LOC107569183,LOC107684783,LOC107751715,LOC107560533 coding upstream 450718 4238766 ~ 4251066 (+)
erbb2 erbb2,LOC107684762,LOC107751707,LOC107753308,LOC107560555,LOC107573419,LOC107694064 coding upstream 482392 4192254 ~ 4219392 (+)
pgap3 pgap3,LOC107694083,LOC107684764 coding upstream 516326 4176537 ~ 4185458 (+)
LOC122355390 grid1b,grid1,LOC107551832,LOC106589364,LOC106578986 coding downstream 356435 5184018 ~ 5237596 (+)
patl2 LOC107653257,LOC107716475,LOC107551853,LOC107674477,LOC107727969 coding downstream 504597 5332180 ~ 5337922 (+)
cmn NA coding downstream 513520 5341103 ~ 5355542 (+)
paqr4b paqr4b,LOC107716446,LOC107653249,LOC107727949,LOC107674534,LOC107576563,LOC107551829 coding downstream 528771 5356354 ~ 5359854 (+)
ppp1cab ppp1cab,LOC107551850,LOC107674520,LOC107556769,LOC108413689,LOC108280818,LOC108274218 coding downstream 539941 5367524 ~ 5372985 (+)
G85552 NA non-coding upstream 388754 4312579 ~ 4313030 (+)
G85550 NA non-coding upstream 389840 4311467 ~ 4311944 (+)
G85477 NA non-coding upstream 472250 4228755 ~ 4229534 (+)
G85444 NA non-coding upstream 702305 3992786 ~ 3999479 (+)
G85332 NA non-coding upstream 912916 3761302 ~ 3788868 (+)
LOC122355394 NA non-coding downstream 315317 5142900 ~ 5144378 (+)
LOC122355395 NA non-coding downstream 327071 5154654 ~ 5157732 (+)
G85661 NA non-coding downstream 569980 5397563 ~ 5402712 (+)
G85683 ghdc,LOC107556765,LOC107727961 non-coding downstream 655991 5483574 ~ 5485749 (+)
G85685 NA non-coding downstream 664131 5491714 ~ 5492934 (+)
G85567 NA other upstream 248509 4452855 ~ 4453275 (+)
LOC122355720 gnrh2,LOC107750862,LOC107671109 other upstream 282571 4418247 ~ 4419213 (+)
LOC122355090 ebf4,ebf3,LOC107750882,LOC107668586,LOC107671096 other upstream 293379 4399596 ~ 4408405 (+)
ndufa4b ndufa4,ndua4,LOC107745684,LOC107569184,LOC107684782,LOC103023526,LOC108443163 other upstream 424399 4275340 ~ 4277385 (+)
btbd16 btbd16,LOC107660483,LOC107716451,LOC107598041 other upstream 1433945 3254718 ~ 3267839 (+)
LOC122355392 pnmt,LOC107571312,LOC107676565 other downstream 253582 5081165 ~ 5109046 (+)
G85587 NA other downstream 261342 5088925 ~ 5089638 (+)
drosha drosha,rnasen,LOC107716466,LOC107727962,LOC107556767 other downstream 598998 5426581 ~ 5446719 (+)
LOC122355829 tgfb1i1 other downstream 938814 5766397 ~ 5816315 (+)
becn1 becn1,atg6 other downstream 1059369 5886952 ~ 5953486 (+)

Expression


Co-expression Network