G3026



Basic Information


Item Value
gene id G3026
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 4815674 ~ 4815882 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU3383
ATTGTACTGAACTGCGTATGTGCGTGATGAGATACGGTCCTTGTCGCAGGTCCTAGCAGATAGATACAACTGTAAAATGCTCACTGCTGTTCACCGTGCGAGAATGACTGAAAAAAGTCAGGAATCGACAAACAGAATCGAAATGCGCGCATCGTATCAAATACCCGGTTCTTTGAAATTTGGAACCGGTTCTCGATACCCAACCCTAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU3383 True 209 lncRNA 0.51 1 4815674 4815882

Neighbor


gene id symbol gene type direction distance location
CI01000000_04728056_04730605 NA coding downstream 84903 4727845 ~ 4730771 (-)
CI01000000_04597720_04599733 NA coding downstream 215505 4597518 ~ 4600169 (-)
CI01000000_04589952_04595231 PPID coding downstream 219893 4589952 ~ 4595781 (-)
CI01000000_04587327_04589208 NA coding downstream 226466 4586959 ~ 4589208 (-)
CI01000000_04568874_04570653 NA coding downstream 244292 4568574 ~ 4571382 (-)
CI01000000_04924131_04926561 NA coding upstream 108176 4924058 ~ 4926766 (-)
CI01000000_04986976_04998622 NA coding upstream 170827 4986709 ~ 4999019 (-)
CI01000000_05286804_05288152 NA coding upstream 470906 5286788 ~ 5288214 (-)
CI01000000_05311908_05314253 NA coding upstream 494859 5310741 ~ 5314256 (-)
CI01000000_05380329_05386853 ANXA5A coding upstream 564173 5380055 ~ 5386853 (-)
G3023 NA non-coding downstream 18628 4796800 ~ 4797046 (-)
G3012 NA non-coding downstream 74075 4741376 ~ 4741599 (-)
G3007 NA non-coding downstream 88323 4726990 ~ 4727351 (-)
G3006 NA non-coding downstream 89229 4725986 ~ 4726445 (-)
G3005 NA non-coding downstream 90212 4725251 ~ 4725462 (-)
G3034 NA non-coding upstream 14629 4830511 ~ 4830734 (-)
G3060 NA non-coding upstream 67528 4883410 ~ 4883632 (-)
G3072 NA non-coding upstream 93244 4909126 ~ 4909406 (-)
G3119 NA non-coding upstream 147906 4963788 ~ 4964127 (-)
G3129 NA non-coding upstream 156828 4972710 ~ 4972985 (-)
G2730 NA other downstream 425522 4386383 ~ 4390152 (-)
CI01000000_04079738_04081018 MIF other downstream 734557 4078121 ~ 4081117 (-)
G2484 NA other downstream 1242120 3570066 ~ 3573554 (-)
CI01000000_03564077_03564373 NA other downstream 1248583 3562887 ~ 3567571 (-)
CI01000000_03245643_03246684 NA other downstream 1568959 3245134 ~ 3246721 (-)
CI01000000_05465020_05466303 NA other upstream 648176 5464058 ~ 5466516 (-)
G3650 NA other upstream 724581 5540463 ~ 5540881 (-)
G3716 NA other upstream 1184525 6000407 ~ 6000769 (-)
G3931 NA other upstream 1341131 6157013 ~ 6403525 (-)
CI01000000_10407402_10409508 UBL3B, UBL3.S, UBL3 other upstream 5588446 10407395 ~ 10409950 (-)

Expression



Co-expression Network