G90311 (polh)


Basic Information

Item Value
gene id G90311
gene name polh
gene type unknown
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056711.1
NCBI id CM032080.1
chromosome length 25085836
location 2626328 ~ 2627157 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU133704
GGCGCGCGACGCTCGGGCAGCAGAAGAAGAGCGCGCGCTGAGCGTCTCTCCCGAGTGGAAGTGTCCATGGATTTTGGGAAGGAGAGAGTGGTCGCGCTGGTGGACATGGATTGCTTCTATGTGCAGGTGGAGCAGAGGATCAACCCCGAGCTCAAAAACAAACCCTGCGTGGTGGCGCAGTACAAGACGTGGAAAGGCGGAGGCATCATAGCCGTGAGTTACGAGGCCAGAGCTCATGGGGTCAGCAGGAACATGTGGGCAGATGATGCCAGGAAGCTCTGTCCTGACCTGCAGGTGGCCCGAGTCAGAGAGGCTCATGGGAAGGCTGATCTCACGCTTTACAGGGAGGCCAGCGTGGAGGTGATCGAGGTGATGTCGCGCTTCGCCGTCATAGAGAGGGCCAGCATCGACGAGGCGTACATGGACCTCACGGGCAGCGTCCAGGAGCGACTGAAGCACATGAGCGTCCAGGAC

Function

symbol description
polh Predicted to enable DNA-directed DNA polymerase activity. Predicted to be involved in error-prone translesion synthesis and response to radiation. Predicted to act upstream of or within DNA biosynthetic process and DNA repair. Predicted to be active in nucleus; replication fork; and site of double-strand break. Human ortholog(s) of this gene implicated in xeroderma pigmentosum variant type. Orthologous to human POLH (DNA polymerase eta).

NR:

description
PREDICTED: DNA polymerase eta isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU133704 True 474 TUCP 0.60 3 2626328 2627157

Neighbor

gene id symbol gene type direction distance location
LOC122356217 LOC107719934,LOC107699158,LOC107597732 coding downstream 17460 2607080 ~ 2608868 (-)
LOC122356775 gtpbp2,LOC107751133,LOC107701968,LOC107699157 coding downstream 128907 2488427 ~ 2497421 (-)
gsta.1 LOC107701971,LOC107734005 coding downstream 145999 2478583 ~ 2480329 (-)
LOC122356433 LOC107680168,LOC107571251,LOC107567524,LOC107563091,LOC107676802,LOC107653882,LOC107756192,LOC107560357,LOC107717306 coding downstream 160062 2458880 ~ 2466266 (-)
LOC122356487 LOC107654083,LOC107715618,LOC107727478 coding downstream 169265 2439206 ~ 2457063 (-)
si:zfos-1056e6.1 si:zfos-1056e6.1 coding upstream 221016 2848173 ~ 2853384 (-)
LOC122356239 LOC107702675,LOC107754747,LOC107564209,LOC107660246,LOC107559771,LOC107754739 coding upstream 234851 2862008 ~ 2865825 (-)
LOC122356237 syndig1,LOC107564210,LOC107702699,LOC107559783,LOC107660247,LOC107728059 coding upstream 264230 2891387 ~ 2913516 (-)
tuba4l tuba4l,LOC107669576,LOC107706828,LOC107564211,LOC107655627,LOC107559781,LOC108256914 coding upstream 326082 2953239 ~ 2955452 (-)
LOC122356071 mea1,LOC107739467,LOC107696388,LOC107728068,LOC107564221 coding upstream 423391 3050548 ~ 3052828 (-)
G90312 NA non-coding downstream 1055 2624904 ~ 2625273 (-)
G90300 NA non-coding downstream 2419 2621236 ~ 2623909 (-)
LOC122356206 NA non-coding downstream 123870 2500535 ~ 2502458 (-)
G90271 NA non-coding downstream 144686 2481370 ~ 2481642 (-)
LOC122356497 NA non-coding downstream 182844 2442247 ~ 2443484 (-)
G90408 NA non-coding upstream 269881 2897038 ~ 2897468 (-)
G90431 NA non-coding upstream 316553 2943710 ~ 3194742 (-)
G90432 NA non-coding upstream 323141 2950298 ~ 3201099 (-)
G90437 LOC107739478,LOC107564218 non-coding upstream 347839 2974996 ~ 2977696 (-)
G90441 znf318,LOC107739464,LOC107564219,LOC107728066 non-coding upstream 358779 2985936 ~ 3013736 (-)
G90304 NA other downstream 40997 2584196 ~ 2585331 (-)
G90161 tp53bp2,LOC107582030,LOC107705014,LOC107742808 other downstream 381250 2151837 ~ 2245078 (-)
LOC122356758 ccdc88a,LOC107571560,LOC107701441,LOC107570323,LOC107695193 other downstream 933974 1684449 ~ 1692354 (-)
LOC122356439 LOC107747448,LOC107690165,LOC107678593,LOC107582517,LOC107576986,LOC107708380 other downstream 1069281 1554230 ~ 1557047 (-)
si:dkey-228d14.5 si:dkey-228d14.5,LOC107747455,LOC107582513,LOC107708394,LOC107589525,LOC107678589,LOC107690177 other downstream 1338046 1212870 ~ 1288282 (-)
G90445 znf318,LOC107739464,LOC107655625,LOC107728066,LOC107559766 other upstream 363261 2990418 ~ 3244896 (-)
dlk2 dlk2,LOC107669558,LOC107696386,LOC107559779,LOC107728069 other upstream 654180 3281337 ~ 3298549 (-)
timm23b timm23b,timm23a,LOC107565600,LOC107669571,LOC107739474,LOC108263229,LOC108426535 other upstream 795596 3422753 ~ 3435580 (-)
wu:fj16a03 NA other upstream 1324606 3951763 ~ 3955955 (-)
hcar1-3 LOC107590023,LOC107678489,LOC107707144,LOC107699282,LOC107586503,LOC107736563 other upstream 1425586 4052743 ~ 4055413 (-)

Expression


Co-expression Network