tmem14a (zgc:163080,LOC107751370,LOC107701972,LOC107579763,LOC107597714)


Basic Information

Item Value
gene id tmem14a
gene name zgc:163080,LOC107751370,LOC107701972,LOC107579763,LOC107597714
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056711.1
NCBI id CM032080.1
chromosome length 25085836
location 2477593 ~ 2478849 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043256327.1
GTTCTGGCGTCATCATGTCGTCACTTCCTTGTTATGAACTTCAGCACAGATCAGAATCAGATCAGAGTCAGGCTGCTGCTGCTATCAGTCCAGCTCAAGCGCAACTTCTGCCCGCTCTCTTCCAGCCGGTTCACCACAGCACCCGCGGTCTCTAGCACAGAATGGCAGTGGACTGGTGGGGCTTCGCTTATGCTGCAGCTCTGGCTTTGGGCGGCTTCATGGGCTATAAAAGAAAAGGAAGCGTGGTGTCATTAATTGCCGGACTCTTCTTTGGAAGCGTGTCCGCGTATGGAGCATACAGAATAACGAACGATCCGCACGATTACTGGACCTCTCTCGTCTCCGCCGGTGTTCTGACCGTTGTGATGGGAATGAGATTCAGGAAATCTGGGAAACTAATGCCTGCGGGAATCATGGCAGGACTGAGCCTCCTCATGGTTTTGCGACTTCTGATCTACTAAAAGCTGACGGACAGGCCACGCCGGGACCTTTCTCTCAACATCCACCGGACAGTTTCATCATTCGTTTCACAGCATCTTCACTTCTTCCCATCAAACTGTATCTTGCACATTCCAAATAAATCTGTCCATTTTAGA

Function

symbol description
zgc:163080 Predicted to be involved in mitochondrial transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in mitochondrial membrane. Orthologous to human TMEM14A (transmembrane protein 14A).

NR:

description
PREDICTED: uncharacterized protein LOC107751370

GO:

id name namespace
GO:0016020 membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043256327.1 True 596 mRNA 0.51 5 2477593 2478849

Neighbor

gene id symbol gene type direction distance location
LOC122356456 LOC107710218 coding upstream 27180 2446050 ~ 2450413 (+)
LOC122356459 LOC107715620,LOC107654086,LOC107727476,LOC107571253 coding upstream 44910 2428760 ~ 2432683 (+)
nrxn1b LOC107654084,LOC107582113,LOC107699145,LOC107758571,LOC107558206,LOC107738897 coding upstream 52862 2314506 ~ 2424731 (+)
LOC122356461 cox15,LOC107753717,LOC107582029,LOC108437854,LOC108260879,LOC102219127 coding upstream 253140 2217871 ~ 2224453 (+)
abcc2 abcc2,LOC107758572,LOC107582114,LOC107654078,LOC107558209 coding upstream 260573 2199984 ~ 2217020 (+)
polh polh coding downstream 3353 2482202 ~ 2488135 (+)
LOC122356205 LOC107719934,LOC107699158,LOC107597732 coding downstream 21833 2500682 ~ 2502321 (+)
ppm1g ppm1g,LOC107660231,LOC107717838,LOC107754752,LOC107702697 coding downstream 361001 2839850 ~ 2846260 (+)
LOC122356236 apmap,LOC107702698,LOC107564208,LOC107717839,LOC107559784 coding downstream 373714 2852563 ~ 2860667 (+)
LOC122357122 cul9,LOC107655624,LOC107669557 coding downstream 438043 2916892 ~ 2951762 (+)
G90220 NA non-coding upstream 40084 2437106 ~ 2437509 (+)
G90214 NA non-coding upstream 154629 2322609 ~ 2322964 (+)
LOC122356488 NA non-coding upstream 166458 2309881 ~ 2311135 (+)
LOC122356495 NA non-coding upstream 173517 2303485 ~ 2304076 (+)
G90206 NA non-coding upstream 191349 2285525 ~ 2286244 (+)
G90232 NA non-coding downstream 2520 2481369 ~ 2481775 (+)
G90290 NA non-coding downstream 146089 2624938 ~ 2625283 (+)
G90292 NA non-coding downstream 150343 2629192 ~ 2629607 (+)
G90319 tuba4l,LOC107655627,LOC107559781,LOC107564211,LOC107706828,LOC107669576 non-coding downstream 378476 2857325 ~ 3204019 (+)
LOC122356240 NA non-coding downstream 386958 2865807 ~ 2881686 (+)
G90230 NA other upstream 7212 2469945 ~ 2470381 (+)
LOC122356772 pim3,LOC107732271 other upstream 192786 2264746 ~ 2284807 (+)
cutc cutc other upstream 296764 2176009 ~ 2180829 (+)
tp53bp2a tp53bp2,LOC107582030,LOC107705014,LOC107558217,LOC107742808 other upstream 311565 2153422 ~ 2166028 (+)
lgi1a lgi1a,lgi3,LOC107565913,LOC107701579,LOC107753733,LOC108260544 other upstream 480283 1989872 ~ 1997310 (+)
LOC122356072 znf318,LOC107739464,LOC107564219,LOC107728066 other downstream 503710 2982559 ~ 3010641 (+)
LOC122356070 dnph1 other downstream 573133 3051982 ~ 3278260 (+)
G90350 dlk2,LOC107696386,LOC107669558,LOC107559779,LOC107728069 other downstream 695886 3174735 ~ 3285406 (+)
G90349 NA other downstream 700578 3179427 ~ 3179933 (+)
G90324 cul9,LOC107564217,LOC107669557,LOC107559769,LOC107655624,LOC107706827 other downstream 708977 3187826 ~ 3192113 (+)

Expression


Co-expression Network