gphb5 (gphb5,LOC104954562)


Basic Information

Item Value
gene id gphb5
gene name gphb5,LOC104954562
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056711.1
NCBI id CM032080.1
chromosome length 25085836
location 14485066 ~ 14487500 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043256342.1
ATGGCTCCAATGCGGTCTGGTGCACAGGGACTGTGCTGTGTGACACTGATTGTTTGGCTGTGTTGTGGAGCTCATACTGAGGCCTCTGCGCTCAACCTGAAACGCTTCATCGGCTGCGCAGTCAGAGAGTTTACCTTTCTGGCCCGTAAGCCGGGATGCGGCGGGCTGCACATCACCACCGATGCCTGCTGGGGACGCTGCGAGACCTGGGAAAAGCCTGTCCTGGACCCGCCCTTCATCGAGTCACATCAGCGCGTCTGCACTTATAACGAAACTCGGCTGGAGACGGTACGACTGCCGAACTGCTCAGCAGACGTGGACCCGTCCTACACCTACCCCGTGGCCCTCCGCTGCGACTGTGGGGTTTGTCTCACTAGCACCACTGAATGCATCACTTCGGTCTGA

Function

symbol description
gphb5 Predicted to contribute to hormone activity. Predicted to be involved in G protein-coupled receptor signaling pathway and regulation of thyroid hormone mediated signaling pathway. Predicted to be located in extracellular region. Predicted to be active in cytoplasm and extracellular space. Orthologous to human GPHB5 (glycoprotein hormone subunit beta 5).

NR:

description
PREDICTED: glycoprotein hormone beta-5

GO:

id name namespace
GO:0005576 extracellular region cellular_component
GO:0005179 hormone activity molecular_function

KEGG:

id description

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043256342.1 True 405 mRNA 0.59 3 14485066 14487500

Neighbor

gene id symbol gene type direction distance location
esr2b LOC107736782,LOC107683586 coding upstream 91879 14377594 ~ 14393187 (+)
tmx1 tmx1,LOC107654918,LOC107602932,LOC107736746,LOC107683560,LOC107705366 coding upstream 140205 14339891 ~ 14344861 (+)
atl1 atl1,LOC107705445,LOC107602974,LOC107736665,LOC107682422,LOC107553217 coding upstream 208627 14268377 ~ 14276439 (+)
dmac2l atp5s,LOC107705443,LOC107602971,LOC107654946,LOC107736634,LOC107553216 coding upstream 249033 14232374 ~ 14236033 (+)
LOC122356518 LOC107705440,LOC107654948,LOC107736540,LOC107682154,LOC100538248 coding upstream 275681 14200850 ~ 14209385 (+)
phf3 LOC107665590,LOC107726593,LOC107602981,LOC107736851,LOC107683665,LOC107553234 coding downstream 132665 14620165 ~ 14630849 (+)
zgc:171579 zgc:171579,LOC107665586,LOC107568696,LOC107736860,LOC107747305,LOC107579559,LOC107664312 coding downstream 352282 14839782 ~ 14842432 (+)
adgrb3 adgrb3,LOC107664175,LOC107665593,LOC107736840,LOC107747274 coding downstream 386415 14873915 ~ 15011010 (+)
zgc:172136 LOC107665601,LOC107601056,LOC107747271,LOC107664217,LOC107736845 coding downstream 790860 15278360 ~ 15295194 (+)
golga7bb golga7bb,LOC107728443,LOC107702732,LOC107665585,LOC103368019,LOC108247940 coding downstream 1094368 15581868 ~ 15607881 (+)
G93766 LOC107705365,LOC107736713,LOC107553220,LOC107683494,LOC107602921 non-coding upstream 162982 14318780 ~ 14322084 (+)
G93755 NA non-coding upstream 176684 14306996 ~ 14308382 (+)
G93745 sav1,LOC107705447,LOC107654943,LOC107736858,LOC107602931,LOC107682971,LOC107553191 non-coding upstream 200289 14282769 ~ 14284777 (+)
G93743 NA non-coding upstream 208191 14276615 ~ 14276875 (+)
G93736 NA non-coding upstream 235544 14248765 ~ 14249522 (+)
G93818 NA non-coding downstream 44522 14532022 ~ 14532317 (+)
G93834 sgpp1,LOC107602978,LOC107726595,LOC107553224,LOC107683631 non-coding downstream 75891 14563391 ~ 14567101 (+)
G93835 NA non-coding downstream 80825 14568325 ~ 14568913 (+)
G93836 NA non-coding downstream 81655 14569155 ~ 14569697 (+)
G93839 sgpp1,LOC107726595,LOC107602978,LOC107683631 non-coding downstream 87880 14575380 ~ 14576330 (+)
frmd6 frmd6,LOC107654939,LOC107683538,LOC107736757,LOC107726597 other upstream 115509 14354115 ~ 14369557 (+)
gmfb gmfb,LOC107705437,LOC107553212,LOC107602964,LOC102779377 other upstream 296073 14185315 ~ 14188993 (+)
G93613 NA other upstream 575463 13739607 ~ 13909603 (+)
LOC122356417 mfsd2aa,LOC107654966,LOC107705421,LOC107602949,LOC107739898 other upstream 724332 13749135 ~ 13760734 (+)
tasp1 tasp1,LOC107705405,LOC107654993,LOC107600565,LOC107662811,LOC107585512,LOC107739887 other upstream 1326626 13134473 ~ 13158440 (+)
LOC122357077 zgc:153049,LOC107747287,LOC107736842,LOC107665562,LOC107664273,LOC107573610,LOC107553186 other downstream 618958 15106458 ~ 15226722 (+)
fam135a LOC107747270,LOC107665594,LOC107736843,LOC107664195,LOC107564672 other downstream 767574 15255074 ~ 15275234 (+)
tarbp1 tarbp1,si:dkey-85a20.4,LOC107736847,LOC107564676,LOC107683215 other downstream 808349 15295849 ~ 15314656 (+)
LOC122356934 LOC107747267,LOC107665602,LOC107601027 other downstream 827314 15314814 ~ 15318177 (+)
hps1 hps1,LOC107747297,LOC107665607,LOC107719211,LOC107702747,LOC107586068 other downstream 1377339 15864839 ~ 15871816 (+)

Expression


Co-expression Network