G8161


Basic Information

Item Value
gene id G8161
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 11144751 ~ 11144973 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU8988
TTAATGGTCACTAAGATGTCAGCCATAGTCTTTACACATCAGTCACCGAGGGCTGTCTTATTTATTTTTACCGTTGTTCTCGCCTCTTCTCTTCTTTGTTTTTTCCTCTTTTCTTGTGTCAGGTATTTAAGCAGGCTGTCAGTTTTATAGGGCCTGGTGAATGGGGTTGATAGGGGAGACTCTCAAAGGACTGCATGTGACCCATCTGCCCACAACACCCTCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU8988 True 223 lncRNA 0.45 1 11144751 11144973

Neighbor

gene id symbol gene type direction distance location
CI01000000_11108925_11118542 NA coding downstream 25394 11108681 ~ 11119357 (-)
CI01000000_11066680_11069224 ZIC3 coding downstream 74491 11066457 ~ 11070461 (-)
CI01000000_10998739_11000052 GPR101 coding downstream 142870 10998464 ~ 11001881 (-)
CI01000000_10979945_10982820 RBMX coding downstream 161931 10979639 ~ 10982820 (-)
CI01000000_10945347_10977876 ARHGEF6 coding downstream 166875 10943882 ~ 10977876 (-)
CI01000000_11192339_11212425 FGF13 coding upstream 47176 11192149 ~ 11212438 (-)
CI01000000_11229749_11245295 NA coding upstream 84610 11229583 ~ 11253442 (-)
CI01000000_11318462_11334893 NA coding upstream 172738 11317711 ~ 11335314 (-)
CI01000000_11344232_11366443 MCF2, MCF2A coding upstream 198336 11343309 ~ 11366443 (-)
CI01000000_11384532_11410549 ATP11C coding upstream 239559 11384532 ~ 11410549 (-)
G8155 NA non-coding downstream 10054 11134400 ~ 11134697 (-)
G8142 NA non-coding downstream 45198 11099192 ~ 11099553 (-)
G8132 NA non-coding downstream 86958 11056844 ~ 11057793 (-)
G8131 NA non-coding downstream 89488 11054713 ~ 11055263 (-)
G8172 NA non-coding upstream 30781 11175754 ~ 11176024 (-)
G8180 NA non-coding upstream 47994 11192967 ~ 11193175 (-)
G8251 NA non-coding upstream 469753 11614726 ~ 11614965 (-)
G8246 NA non-coding upstream 473881 11618854 ~ 11619745 (-)
G8253 NA non-coding upstream 475128 11620101 ~ 11620367 (-)
G8125 NA other downstream 103842 11040269 ~ 11040909 (-)
CI01000000_10824957_10825464 MMGT1, TMM32 other downstream 317156 10824324 ~ 10825464 (-)
CI01000000_10407402_10409508 UBL3B, UBL3.S, UBL3 other downstream 730238 10407395 ~ 10409950 (-)
G3931 NA other downstream 4741226 6157013 ~ 6403525 (-)
G3716 NA other downstream 5143982 6000407 ~ 6000769 (-)
G8699 NA other upstream 2140351 13272585 ~ 13311429 (-)
G9036 NA other upstream 2581827 13726800 ~ 13727090 (-)
G9602 NA other upstream 3196029 14341002 ~ 14346534 (-)
CI01000000_14200000_14436182 TENM2 other upstream 3240384 14200000 ~ 14436253 (-)
G10672 NA other upstream 5081314 16226287 ~ 16231126 (-)

Expression


Co-expression Network