G105550 (ncam1b,LOC107713449)


Basic Information

Item Value
gene id G105550
gene name ncam1b,LOC107713449
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056713.1
NCBI id CM032082.1
chromosome length 23709629
location 10786021 ~ 10796377 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU155881
AGCTTTGTATCTGACCAAATAATGGGTGATTGGTGACCCTCCGTCGTCTTGTTTGGTCCATTTCACTTTAAGAGAATTGCCTTTGGGTTGTAGGGTGCCCTCTAGTATAGGAGGACTTGGTTCTCCTCGGACATGCTCGGTTTTGAAGACCAGTGACTGGCTGCTGTCGCCTTCGCCCTTGCCGTTGATGGCAGACATCTTGACTTCGTAATCGGTTTCGGGTTTTAGGCCGGTGACCGTGACTGAACTCAGTCCTGTTGGGAGATTTAATCGAAAACCCATTCATTCATTAACAACAGCACGCATGCTAAATGGGAAACATAAA

Function

symbol description
ncam1b Acts upstream of or within axon guidance. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in neuron projection. Is expressed in nervous system; otic vesicle; posterior neural keel; spinal cord neural rod; and spinal cord neural tube. Human ortholog(s) of this gene implicated in bipolar disorder; middle cerebral artery infarction; and pancreatic cancer. Orthologous to human NCAM1 (neural cell adhesion molecule 1).

NR:

description
PREDICTED: neural cell adhesion molecule 1-like isoform X7

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU155881 True 325 lncRNA 0.47 2 10786021 10796377

Neighbor

gene id symbol gene type direction distance location
dixdc1a dixdc1a,dixdc1,LOC107713457,LOC107701411,LOC107699911,LOC107717189 coding upstream 113421 10663810 ~ 10672600 (+)
LOC122359094 LOC107713423,LOC107701398,LOC107597513,LOC107659919,LOC107717187 coding upstream 205340 10564489 ~ 10580681 (+)
LOC122358614 LOC107713423,LOC107701398,LOC107659919,LOC107597513,LOC107717187,LOC107676612 coding upstream 227843 10544727 ~ 10558178 (+)
LOC122359095 LOC107713423,LOC107701398,LOC107659919,LOC107717187,LOC107597513,LOC107582627 coding upstream 246958 10521693 ~ 10539063 (+)
LOC122358985 LOC107701419,LOC107713466,LOC107728785,LOC107597592,LOC100001991,LOC107582628 coding upstream 344723 10431565 ~ 10441298 (+)
cadm1b cadm1b,LOC107713448,LOC107582575,LOC107662762,LOC107699904,LOC107748594,LOC108435304 coding downstream 86157 10882534 ~ 11028778 (+)
LOC122359106 LOC107582581,LOC107713463,LOC107701416,LOC107597512,LOC107717185,LOC107659920 coding downstream 338976 11135353 ~ 11138624 (+)
LOC122359111 pou2af1,LOC107582583,LOC107717181,LOC107713464,LOC107597594 coding downstream 365707 11162084 ~ 11172203 (+)
LOC122358387 LOC107717180,LOC107597510,LOC107713465,LOC107582585 coding downstream 458946 11255323 ~ 11259381 (+)
LOC122358473 LOC107701401,LOC107713429,LOC107582582,LOC107659936,LOC107717183 coding downstream 494976 11291353 ~ 11297720 (+)
G105546 NA non-coding upstream 83 10779248 ~ 10785938 (+)
G105539 NA non-coding upstream 10668 10753433 ~ 10775353 (+)
G105526 si:ch211-247l8.8,LOC107597517,LOC108413672,LOC108441967,LOC108413998 non-coding upstream 89227 10692341 ~ 10696794 (+)
G105525 si:ch211-247l8.8,LOC107597517,LOC108413672,LOC108441967,LOC108413998 non-coding upstream 93236 10687344 ~ 10692785 (+)
G105517 pih1d2,LOC107701408,LOC107577555,LOC107597596,LOC107699912 non-coding upstream 110506 10672765 ~ 10675515 (+)
G105587 LOC107748591,LOC107582621,LOC107713446 non-coding downstream 276946 11073323 ~ 11452038 (+)
LOC122359117 NA non-coding downstream 302477 11098854 ~ 11100427 (+)
G105601 LOC107713465,LOC107717180,LOC107597510 non-coding downstream 383655 11180032 ~ 11185102 (+)
G105622 LOC107662753,LOC107729089,LOC107662756,LOC107717280,LOC107657263 non-coding downstream 533548 11329925 ~ 11330320 (+)
G105623 LOC107729090,LOC107662800,LOC107586245 non-coding downstream 534043 11330420 ~ 11331300 (+)
G105513 zbtb16b,zbtb16,LOC107597519,LOC107748597,LOC107582577,LOC107701406,LOC107713452,LOC108278332 other upstream 57626 10721972 ~ 10728395 (+)
snx19b LOC107713467,LOC107701420,LOC107659921,LOC107728781,LOC107597509 other upstream 395421 10353161 ~ 10390600 (+)
G105248 NA other upstream 578569 10204839 ~ 10207452 (+)
ypel2b LOC107659943,LOC101067200,LOC106931471,LOC106940241,LOC106603438 other upstream 675578 10093455 ~ 10110443 (+)
dusp14 dusp14,LOC107661112,LOC107672422,LOC107727911,LOC107554288,LOC107713882,LOC107582606 other upstream 1070332 9703426 ~ 9715689 (+)
LOC122358628 NA other downstream 573871 11370248 ~ 11372691 (+)
LOC122358755 LOC107729119,LOC107586264,LOC107597546,LOC108425821,LOC107662788 other downstream 1231178 12027555 ~ 12030549 (+)
tnfaip1 tnfaip1,LOC107586309,LOC107729096,LOC107662792,LOC107657549,LOC107597551,LOC107728221,LOC108425816 other downstream 1297580 12093957 ~ 12097646 (+)
spa17 spa17,nrgnb,LOC107709112,LOC107696004,LOC107586300,LOC108278372,LOC107601687,LOC107657238,LOC107717271 other downstream 2041205 12837582 ~ 12848667 (+)
G106376 cluh,LOC107685050 other downstream 3120196 13916573 ~ 13917262 (+)

Expression


Co-expression Network