G106678 (wdr81,LOC107664921,LOC107743652,LOC107685063,LOC107744800,LOC107562947)


Basic Information

Item Value
gene id G106678
gene name wdr81,LOC107664921,LOC107743652,LOC107685063,LOC107744800,LOC107562947
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056713.1
NCBI id CM032082.1
chromosome length 23709629
location 14531217 ~ 14531538 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU157608
GCAGCCGGTCTCCCTGGCTAATCGGTATCCTAGCTTGCGCTTTCTAAGGCCTTGGATACAAACGCGTGTCCAACCAGATGGCAATTTCATCTGAGAGCGCTGGAGGAGAGTGCAGATTTCTCCCTCGCTGAAGCACTCGTATCGTGCACAGCGTGTAACTCTCTTATTTCTCAGGGCCATTACCCATCGAGTTGGGACCAGGACCACCAGTTCATTGGGTCGCTCACTGGGTCTAGTCTGCCGCTGATCAATACCCAGGTCCCTCTCCAAGGCTGGCGCTAGCCACTCCATGATCTCTTCCGCTTAACTAGACTGTGGCCCT

Function

symbol description
wdr81 Predicted to enable phosphatidylinositol 3-kinase regulator activity. Predicted to be involved in several processes, including aggrephagy; early endosome to late endosome transport; and regulation of phosphatidylinositol 3-kinase activity. Predicted to be located in bounding membrane of organelle and cytosol. Predicted to be extrinsic component of endosome membrane. Is expressed in several structures, including heart; liver; nervous system; optic vesicle; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in cerebellar ataxia, mental retardation and dysequlibrium syndrome and hydrocephalus. Orthologous to human WDR81 (WD repeat domain 81).

NR:

description
PREDICTED: WD repeat-containing protein 81-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU157608 True 322 lncRNA 0.55 1 14531217 14531538

Neighbor

gene id symbol gene type direction distance location
rtn4rl1b LOC107585598,LOC107664898,LOC107743721,LOC107744797,LOC107685061,LOC107592642 coding upstream 74623 14324633 ~ 14456594 (+)
hic1 LOC107743655,LOC107664949,LOC107585597,LOC107685059,LOC107744795 coding upstream 453108 14066366 ~ 14078109 (+)
tsr1 tsr1,LOC107743656,LOC107585596,LOC107685058,LOC107592627,LOC107744794,LOC107664951 coding upstream 477968 14043738 ~ 14053249 (+)
npat LOC107743659,LOC107664943,LOC107585592,LOC107744791,LOC107685055,LOC107592638 coding upstream 527616 13995726 ~ 14003601 (+)
zgc:152863 LOC107743663,LOC107664952,LOC107585590,LOC107592625,LOC107744814,LOC107685175 coding upstream 549225 13976844 ~ 13981992 (+)
slc13a5b slc13a5b,slc13a5,LOC107743744,LOC107548552,LOC107664910,LOC107744815,LOC107685176,LOC107562952,LOC108425802 coding downstream 2191 14533729 ~ 14542684 (+)
slc47a3 LOC107664894,LOC107743743,LOC107548553 coding downstream 15171 14546709 ~ 14553510 (+)
ppm1da ppm1da,LOC107743648,LOC107548567,LOC107664959,LOC107685067,LOC107723873,LOC107562958 coding downstream 153915 14685453 ~ 14691067 (+)
bcas3 bcas3,LOC107743646,LOC107664928,LOC107685068 coding downstream 160041 14691579 ~ 14884914 (+)
tbx2b tbx2b,LOC107757046,LOC107685069,LOC107664937,LOC107743645 coding downstream 361137 14892675 ~ 14900553 (+)
G106648 NA non-coding upstream 274554 14255851 ~ 14256663 (+)
LOC122359060 NA non-coding upstream 352953 14166984 ~ 14178264 (+)
G106614 NA non-coding upstream 364604 14166393 ~ 14166613 (+)
G106603 NA non-coding upstream 447359 14082051 ~ 14083858 (+)
G106249 LOC107585585,LOC107743723,LOC107685050,LOC107664929 non-coding upstream 615532 13915241 ~ 13915685 (+)
G106679 NA non-coding downstream 864 14532402 ~ 14532730 (+)
G106718 pitpnm3,LOC107664939,LOC107685064,LOC107548564,LOC107744810,LOC107562949 non-coding downstream 51789 14583327 ~ 14585666 (+)
G106734 NA non-coding downstream 121758 14653296 ~ 14671494 (+)
LOC122359248 NA non-coding downstream 537559 15069097 ~ 15076291 (+)
G106827 NA non-coding downstream 553657 15085195 ~ 15085431 (+)
aifm4 aifm4,LOC107585620,LOC107685174,LOC107664913,LOC107743746 other upstream 569410 13957197 ~ 13961807 (+)
G106376 cluh,LOC107685050 other upstream 613955 13916573 ~ 13917262 (+)
spa17 spa17,nrgnb,LOC107709112,LOC107696004,LOC107586300,LOC108278372,LOC107601687,LOC107657238,LOC107717271 other upstream 1682550 12837582 ~ 12848667 (+)
tnfaip1 tnfaip1,LOC107586309,LOC107729096,LOC107662792,LOC107657549,LOC107597551,LOC107728221,LOC108425816 other upstream 2433571 12093957 ~ 12097646 (+)
LOC122358755 LOC107729119,LOC107586264,LOC107597546,LOC108425821,LOC107662788 other upstream 2500668 12027555 ~ 12030549 (+)
tbx4 tbx4,LOC107548556,LOC107664909,LOC107757041,LOC107685071,LOC107743740,LOC107589698,LOC106612866 other downstream 381373 14912911 ~ 14928225 (+)
G106937 eml2,LOC107669753,LOC107743713,LOC107548590,LOC107685092 other downstream 1174975 15706513 ~ 15712439 (+)
G107107 NA other downstream 1349576 15881114 ~ 15883510 (+)
gdpd5b gdpd5,gdpd5b,LOC107714175,LOC107666190,LOC107682503,LOC107756554 other downstream 1473331 16004869 ~ 16043265 (+)
G107148 nrip1a,LOC107587564,LOC107714172,LOC107666194,LOC107682571,LOC107756533,LOC107589737 other downstream 1558219 16089757 ~ 16236341 (+)

Expression


Co-expression Network