G106872 (sarm1,LOC107743642,LOC107669752,LOC107548548,LOC107685076,LOC107756984)


Basic Information

Item Value
gene id G106872
gene name sarm1,LOC107743642,LOC107669752,LOC107548548,LOC107685076,LOC107756984
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056713.1
NCBI id CM032082.1
chromosome length 23709629
location 15290156 ~ 15290486 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU157868
GCTGTGAACCGGTAGTGCGACGGTAGCTGATGAACACGTCAGGGCCTGTAGGTTGGGAATCGGTTAAGCAGGGTTTAGCAGGGCGGTGGGCAGAAGAGAGTATCTTGGCACGATGGATTCCATTCTCTACAAGGCAGTCAGACAGCAGCTGCTGGTCTGTAATGTGGACGATATTGTTCCGATCGACTCCTGACTGAACCAAGCCGTAGGTGTACTGACGGAATCGTGGGTCTATTTCAGCCAGCCAGTCTGCCAGGTTATTGGGGTCACATGTGGAGTAGTTAGCATAGGTTTTCAGTACACGCAGATCTCGAAGAAACCTGTACAGAAG

Function

symbol description
sarm1 Enables NAD+ nucleosidase activity. Involved in NAD catabolic process. Predicted to be located in axon; mitochondrion; and synapse. Predicted to be active in dendrite. Orthologous to human SARM1 (sterile alpha and TIR motif containing 1).

NR:

description
PREDICTED: sterile alpha and TIR motif-containing protein 1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU157868 True 331 lncRNA 0.52 1 15290156 15290486

Neighbor

gene id symbol gene type direction distance location
slc46a1 slc46a1,LOC107548560,LOC107669722,LOC107743641,LOC107589753,LOC107685182,LOC107757459 coding upstream 2788 15282512 ~ 15287368 (+)
unc119a unc119a,unc119,LOC107548572,LOC107757471,LOC107669755,LOC107743736,LOC103043060,LOC108431312 coding upstream 24413 15256926 ~ 15265743 (+)
crybb1l3 crybb1l3,LOC107548571,LOC107743737,LOC107669754,LOC108426910,LOC103042748 coding upstream 35449 15251164 ~ 15254707 (+)
tbx2b tbx2b,LOC107757046,LOC107685069,LOC107664937,LOC107743645 coding upstream 389603 14892675 ~ 14900553 (+)
bcas3 bcas3,LOC107743646,LOC107664928,LOC107685068 coding upstream 405242 14691579 ~ 14884914 (+)
vtna LOC107548575,LOC107669719,LOC107685077,LOC107589740 coding downstream 3746 15294232 ~ 15299283 (+)
myo1cb myo1c,LOC107756890,LOC107743634,LOC107685083 coding downstream 39386 15329872 ~ 15367766 (+)
si:dkey-118k5.3 LOC107743635,LOC107548579,LOC107756915,LOC107685081,LOC107589709 coding downstream 77601 15368087 ~ 15373998 (+)
slc43a2a slc43a2,LOC107548581,LOC107685082,LOC107589710,LOC107669718 coding downstream 84397 15374883 ~ 15394089 (+)
pitpnaa pitpna,LOC107743636,LOC107669737,LOC107548584,LOC107685084,LOC107756865 coding downstream 104515 15395001 ~ 15401953 (+)
G106863 NA non-coding upstream 44342 15245605 ~ 15245814 (+)
G106860 NA non-coding upstream 50444 15239383 ~ 15239712 (+)
G106859 NA non-coding upstream 51210 15238617 ~ 15238946 (+)
G106858 NA non-coding upstream 52431 15237518 ~ 15237725 (+)
G106857 NA non-coding upstream 52813 15237105 ~ 15237343 (+)
G106873 sarm1,LOC107548548,LOC107669752,LOC107743642,LOC107685076,LOC107756984 non-coding downstream 343 15290829 ~ 15291163 (+)
G106898 NA non-coding downstream 107236 15397722 ~ 15482672 (+)
G106924 NA non-coding downstream 212072 15502558 ~ 15571162 (+)
G106926 NA non-coding downstream 219831 15510317 ~ 15511110 (+)
G106941 NA non-coding downstream 346688 15637174 ~ 15638029 (+)
tbx4 tbx4,LOC107548556,LOC107664909,LOC107757041,LOC107685071,LOC107743740,LOC107589698,LOC106612866 other upstream 361931 14912911 ~ 14928225 (+)
aifm4 aifm4,LOC107585620,LOC107685174,LOC107664913,LOC107743746 other upstream 1328349 13957197 ~ 13961807 (+)
G106376 cluh,LOC107685050 other upstream 1372894 13916573 ~ 13917262 (+)
spa17 spa17,nrgnb,LOC107709112,LOC107696004,LOC107586300,LOC108278372,LOC107601687,LOC107657238,LOC107717271 other upstream 2441489 12837582 ~ 12848667 (+)
tnfaip1 tnfaip1,LOC107586309,LOC107729096,LOC107662792,LOC107657549,LOC107597551,LOC107728221,LOC108425816 other upstream 3192510 12093957 ~ 12097646 (+)
G106937 eml2,LOC107669753,LOC107743713,LOC107548590,LOC107685092 other downstream 416027 15706513 ~ 15712439 (+)
G107107 NA other downstream 590628 15881114 ~ 15883510 (+)
gdpd5b gdpd5,gdpd5b,LOC107714175,LOC107666190,LOC107682503,LOC107756554 other downstream 714383 16004869 ~ 16043265 (+)
G107148 nrip1a,LOC107587564,LOC107714172,LOC107666194,LOC107682571,LOC107756533,LOC107589737 other downstream 799271 16089757 ~ 16236341 (+)
lyrm9 lyrm9,LOC107756492 other downstream 1222822 16513308 ~ 16514221 (+)

Expression


Co-expression Network