G8254


Basic Information

Item Value
gene id G8254
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 11620559 ~ 11620817 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU9091
TGGGAGTATCTTTACACATTGGAGACAAGCAGCTTGTCAATCTCTCCTGTCCTTTAATGATGTAGAGTTTGTGAGTCTCAAGGTTGAACTCCACTACAAAACAAACCTTAGTCCACATACCTCCCTGAGTACACAATTTGTCACTTTCCTATTTGTGTACTGACCAGTCACATGGACCGTGTCAAAGTCCATATAGTGTTTCCAGATGTTAAAAGAATAGTTCACCCAAAAATGAAAATTCTGTCATCATTTACTCACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU9091 True 259 lncRNA 0.36 1 11620559 11620817

Neighbor

gene id symbol gene type direction distance location
CI01000000_11603826_11605350 SLC25A43 coding downstream 15209 11603800 ~ 11605350 (-)
CI01000000_11600258_11602519 SLC25A5.L, SLC25A6, SLC25A5, ANTS6 coding downstream 17979 11599982 ~ 11602580 (-)
CI01000000_11587766_11588330 NA coding downstream 32229 11587316 ~ 11588330 (-)
CI01000000_11584045_11586744 UBE2A, UBE2B, UBE2AL coding downstream 33577 11583971 ~ 11586982 (-)
CI01000000_11541564_11559682 INPPL1B coding downstream 60877 11541451 ~ 11559682 (-)
CI01000000_11644676_11648034 CHIC1 coding upstream 23229 11644046 ~ 11648034 (-)
CI01000000_11650257_11652811 CDX1, CDX4 coding upstream 29087 11649904 ~ 11654726 (-)
CI01000000_11661528_11696310 NA coding upstream 40196 11661013 ~ 11696310 (-)
CI01000000_11721762_11759751 DLG3 coding upstream 100750 11721567 ~ 11759751 (-)
CI01000000_11788953_11800880 NA coding upstream 168086 11788903 ~ 11801346 (-)
G8253 NA non-coding downstream 192 11620101 ~ 11620367 (-)
G8246 NA non-coding downstream 814 11618854 ~ 11619745 (-)
G8251 NA non-coding downstream 5594 11614726 ~ 11614965 (-)
G8180 NA non-coding downstream 427384 11192967 ~ 11193175 (-)
G8172 NA non-coding downstream 444535 11175754 ~ 11176024 (-)
G8255 NA non-coding upstream 365 11621182 ~ 11621419 (-)
G8243 NA non-coding upstream 145139 11765956 ~ 11784772 (-)
CI01000000_11894953_11903178 UPF3B non-coding upstream 257703 11893917 ~ 11904097 (-)
G8278 NA non-coding upstream 276344 11897161 ~ 11897363 (-)
G8241 NA non-coding upstream 340178 11960995 ~ 11965822 (-)
G8125 NA other downstream 579650 11040269 ~ 11040909 (-)
CI01000000_10824957_10825464 MMGT1, TMM32 other downstream 792964 10824324 ~ 10825464 (-)
CI01000000_10407402_10409508 UBL3B, UBL3.S, UBL3 other downstream 1206046 10407395 ~ 10409950 (-)
G3931 NA other downstream 5217034 6157013 ~ 6403525 (-)
G3716 NA other downstream 5619790 6000407 ~ 6000769 (-)
G8699 NA other upstream 1664507 13272585 ~ 13311429 (-)
G9036 NA other upstream 2105983 13726800 ~ 13727090 (-)
G9602 NA other upstream 2720185 14341002 ~ 14346534 (-)
CI01000000_14200000_14436182 TENM2 other upstream 2764540 14200000 ~ 14436253 (-)
G10672 NA other upstream 4605470 16226287 ~ 16231126 (-)

Expression


Co-expression Network