G109273


Basic Information

Item Value
gene id G109273
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056714.1
NCBI id CM032083.1
chromosome length 28146790
location 608080 ~ 608431 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU161496
GAACACTGGGGGTTAGTTAGGAGGTTTGAGGCAACTAGAATGGTTCTGCCAATCTTTTCTTGGGGGAGAGAGGCTTGGAAGTTTTTTGAGTCGAGATTTATGCCTAGAAATTCTATGGAAGTACTGGGTCCTGAGGTTTTTTCTTGGGCTAGGGGAATTCCAAGCTCGGCAAAGACTTTTTGGACTGTCAAAAGATTGGCCGCTGGGATAGTGTTTGGAGGAGAAACGATGAGGAAATCTTCGAGGAGATGGATGAGATAAGGAATTTGATAGTTATTACAGAGGATCCAGCAAACTGCTTCGGATAGCATGTCGAAAATTTCGGGGCTACTTTTGCAGCCGAAGGTAAGGC

Function

NR:

description
beta-microseminoprotein E1-like

GO:

id name namespace
GO:0042611 MHC protein complex cellular_component
GO:0042613 MHC class II protein complex cellular_component
GO:0098797 plasma membrane protein complex cellular_component

KEGG:

id description
ko04658 Th1 and Th2 cell differentiation
ko05340 Primary immunodeficiency

RNA

RNA id representative length rna type GC content exon number start site end site
TU161496 True 352 lncRNA 0.45 1 608080 608431

Neighbor

gene id symbol gene type direction distance location
LOC122361256 NA coding downstream 313095 294867 ~ 294985 (-)
LOC122361163 NA coding downstream 329606 278356 ~ 278474 (-)
LOC122361151 NA coding downstream 330001 277961 ~ 278079 (-)
LOC122361280 NA coding downstream 331975 275987 ~ 276105 (-)
LOC122361170 NA coding downstream 333563 274399 ~ 274517 (-)
LOC122361052 foxo1b,LOC107686122,LOC107746988,LOC107588742,LOC107577289,LOC107691691 coding upstream 673880 1282311 ~ 1292313 (-)
LOC122359849 mbp,LOC107661001,LOC107551742,LOC107697274 coding upstream 888155 1496586 ~ 1510434 (-)
pmvk pmvk,LOC107551729,LOC107717898,LOC107735019,LOC107661023,LOC107714427,LOC107697277 coding upstream 936856 1545287 ~ 1549931 (-)
si:ch73-341k19.1 LOC107551746 coding upstream 1039936 1648367 ~ 1654527 (-)
nt5c3a LOC107714420,LOC107661006,LOC107551731,LOC107697280,LOC107720166,LOC107581689 coding upstream 1048117 1656548 ~ 1662627 (-)
LOC122360679 NA non-coding downstream 22577 582333 ~ 585503 (-)
G109248 NA non-coding downstream 157572 450294 ~ 450508 (-)
G109218 NA non-coding downstream 256036 342871 ~ 352044 (-)
LOC122361262 NA non-coding downstream 417567 190395 ~ 190513 (-)
LOC122361244 NA non-coding downstream 427338 180624 ~ 180742 (-)
G109276 NA non-coding upstream 51537 659968 ~ 660352 (-)
G109283 NA non-coding upstream 201602 810033 ~ 810608 (-)
G109292 NA non-coding upstream 357307 965738 ~ 966074 (-)
G109308 zmp:0000001073,LOC107713869,LOC107692477,LOC107566287,LOC107564399 non-coding upstream 505312 1113743 ~ 1195829 (-)
G109316 NA non-coding upstream 672439 1280870 ~ 1281255 (-)
G109275 NA other upstream 24034 632465 ~ 632897 (-)
G109287 NA other upstream 274028 882459 ~ 882752 (-)
prdm1a prdm1,prdm1a,LOC107714407,LOC107697283,LOC107551748,LOC107661008,LOC107581686 other upstream 1132689 1741120 ~ 1964161 (-)
G109600 NA other upstream 2505411 3113842 ~ 3129979 (-)
G109724 LOC107084717,LOC106511825 other upstream 3486326 4094757 ~ 4095504 (-)

Expression


Co-expression Network