G109444 (bmper,LOC107661004,LOC107551747,LOC107697278,LOC107720165)



Basic Information


Item Value
gene id G109444
gene name bmper,LOC107661004,LOC107551747,LOC107697278,LOC107720165
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_056714.1
NCBI id CM032083.1
chromosome length 28146790
location 1645614 ~ 1646149 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence


>TU161719
AAAGAGGTAAAGTCTACAGCAGAATGGCACTTCTGAAACTCCCAGGACTTGAGTTTATGGCACGTTCTGTGAGCACGCAGCTTTACTTTGACCGTGCCGGGACAGAGGAAGGACGTGGGTCTGCGGTTCGGAGCCTGACACACCTCATTGTCCTCCACACGCCAGGACTCAGCAAATTCATCCACGTCAAACTTAATCTGGCCGTCTCCTCCTAGAGAGTCATCCCGTCTTTGACCGTTGTAGTTTCCGCACAGCCCACAGAGCTGGCCCTTCAGATGAGGCGCTGCGACCACCTCCACCAGACTGTCCCCGTCCCACGTGATCTCCAGTCCTGATGACACAGCCAAGG
>TU161720
AAAGAGGTAAAGTCTACAGCAGAATGGCACTTCTGAAACTCCCAGGACTTGAGTTTATGGCACGTTCTGTGAGCACGCAGCTTTACTTTGACCGTGCCGGGACAGAGGAAGGACGTGGGTCTGCGGTTCGGAGCCTGACACACCTCATTGTCCTCCACACGCCAGGACTCAGCAAATTCATCCACGTCAAACTTAATCTGGCCGTCTCCTCCTAGAGAGTCATCCCGTCTTTGACCGTTGTAGTTTCCGCACAGCCCACAGAGCTGGCCCTTCAGATGAGGCGCTGCGACCACCTCCACCAGACTGTCCCCGTCCCACGTGATCTCCAGTCCTGATGACACAGCCAAGGTGATGGTTAAGTAAAAGGAAACGTGCTGCATTTGCCTGCATTCGAGTAAATTACATATCTCGTAGCCTGACACAATAGCACAGGACTCCACACATCCTTcgcacacattattcaccctcctgccagctggaaagaggtaccggagcattcgggccctcacaaccagactgaacagtttcttcccaca

Function


symbol description
bmper Enables extracellular matrix binding activity. Acts upstream of or within several processes, including animal organ development; regulation of BMP signaling pathway; and regulation of angiogenesis. Located in extracellular matrix and extracellular space. Is expressed in several structures, including head; hematopoietic system; mesoderm; nervous system; and pectoral fin. Orthologous to human BMPER (BMP binding endothelial regulator).

NR:

description
PREDICTED: protein PTHB1-like isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU161719 False 349 lncRNA 0.55 1 1645801 1646149
TU161720 True 536 lncRNA 0.53 1 1645614 1646149

Neighbor


gene id symbol gene type direction distance location
pmvk pmvk,LOC107551729,LOC107717898,LOC107735019,LOC107661023,LOC107714427,LOC107697277 coding downstream 95683 1545287 ~ 1549931 (-)
LOC122359849 mbp,LOC107661001,LOC107551742,LOC107697274 coding downstream 135180 1496586 ~ 1510434 (-)
LOC122361052 foxo1b,LOC107686122,LOC107746988,LOC107588742,LOC107577289,LOC107691691 coding downstream 353301 1282311 ~ 1292313 (-)
LOC122361256 NA coding downstream 1350629 294867 ~ 294985 (-)
LOC122361163 NA coding downstream 1367140 278356 ~ 278474 (-)
si:ch73-341k19.1 LOC107551746 coding upstream 2218 1648367 ~ 1654527 (-)
nt5c3a LOC107714420,LOC107661006,LOC107551731,LOC107697280,LOC107720166,LOC107581689 coding upstream 10399 1656548 ~ 1662627 (-)
foxo6a LOC107714419,LOC107551733,LOC107661026,LOC107720174,LOC107697267,LOC107581751 coding upstream 38755 1684904 ~ 1704721 (-)
med18 med18,LOC107714426,LOC107661027,LOC107697268,LOC107720175 coding upstream 71886 1718035 ~ 1720115 (-)
LOC122360634 prdm1,prdm1a,LOC107661008,LOC107551748,LOC107697283,LOC107581686 coding upstream 354632 2000781 ~ 2010666 (-)
G109442 bmper,LOC107551747,LOC107697278,LOC107720165,LOC107661004 non-coding downstream 1441 1643873 ~ 1644173 (-)
G109441 bmper,LOC107661004,LOC107697278,LOC107551747,LOC107720165 non-coding downstream 2571 1642630 ~ 1643043 (-)
G109440 NA non-coding downstream 4302 1640777 ~ 1641312 (-)
G109439 NA non-coding downstream 8617 1636416 ~ 1636997 (-)
G109425 LOC107714432,LOC107661002,LOC107551745,LOC107717891,LOC107697276,LOC107581694 non-coding downstream 103318 1528093 ~ 1542296 (-)
G109460 NA non-coding upstream 90039 1736188 ~ 1997307 (-)
G109465 NA non-coding upstream 171113 1817262 ~ 2078943 (-)
G109466 NA non-coding upstream 181013 1827162 ~ 2085673 (-)
G109471 NA non-coding upstream 293980 1940129 ~ 1941153 (-)
G109481 NA non-coding upstream 573417 2219566 ~ 2225804 (-)
G109287 NA other downstream 762862 882459 ~ 882752 (-)
G109275 NA other downstream 1012717 632465 ~ 632897 (-)
prdm1a prdm1,prdm1a,LOC107714407,LOC107697283,LOC107551748,LOC107661008,LOC107581686 other upstream 94971 1741120 ~ 1964161 (-)
G109600 NA other upstream 1467693 3113842 ~ 3129979 (-)
G109724 LOC107084717,LOC106511825 other upstream 2448608 4094757 ~ 4095504 (-)
vegfaa vegfa,vegfaa,LOC107703930,LOC107559057,LOC107725277,LOC107688978,LOC106605015 other upstream 3586062 5232211 ~ 5245558 (-)
si:dkey-283b15.2 si:dkey-283b15.2,si:dkey-14o18.2,LOC107688992,LOC107559040,LOC107558638,LOC108410647 other upstream 4136518 5782667 ~ 5790534 (-)

Expression



Co-expression Network