G109942 (cyp4t8,LOC107559042,LOC107703932)


Basic Information

Item Value
gene id G109942
gene name cyp4t8,LOC107559042,LOC107703932
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056714.1
NCBI id CM032083.1
chromosome length 28146790
location 5346405 ~ 5347559 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU162462
TCGGGCAGACAGAAGAATATCCAAAAAGTCCAAATATCGTCTGTTTTTAACAATGCCCTGTTCCTTCTCAATCTTCAAGACTTCTTTCCTCTTTCTGATAACTTCTGTATGATTGTGTGCTATTCTGGCCGCCTTCCTGAATTTGTATCCATGTGGACTGAGATGAAATATGGCCTTGCTGTGGTATGGAAACACTCTGAACCTGACGTTCACCAGGTGGCAGAGGTCATACACCGCTTGGATGTACGGGTTGGTTCCA

Function

symbol description
cyp4t8 Predicted to enable several functions, including heme binding activity; iron ion binding activity; and monooxygenase activity. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in myotome; nervous system; otic vesicle; pharyngeal arch 3-7 skeleton; and somite. Human ortholog(s) of this gene implicated in hypertension. Orthologous to several human genes including CYP4B1 (cytochrome P450 family 4 subfamily B member 1).

NR:

description
PREDICTED: cytochrome P450 4B1-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU162462 True 259 lncRNA 0.44 2 5346405 5347559

Neighbor

gene id symbol gene type direction distance location
rrp15 rrp15,LOC107598955,LOC107737032,LOC107703929,LOC107689025 coding downstream 169593 5173650 ~ 5176812 (-)
tgfb2 tgfb2,LOC107598937,LOC106584161 coding downstream 175775 5138694 ~ 5170630 (-)
lyplal1 lyplal1,LOC797125 coding downstream 250810 5090511 ~ 5095595 (-)
adcy3a adcy3,adcy3a,LOC107688975,LOC107703925 coding downstream 299522 5027170 ~ 5046883 (-)
wdr26a LOC107598934,LOC107756916,LOC107562420,LOC107688974,LOC107732721,LOC108270098 coding downstream 321081 5012577 ~ 5025324 (-)
ppp1r8b ppp1r8b,ppp1r8,LOC107564517,LOC107689150,LOC107688979,LOC107713931 coding upstream 8428 5355987 ~ 5360418 (-)
LOC122361376 NA coding upstream 11951 5359510 ~ 5359679 (-)
rpa2 rpa2,LOC107713930 coding upstream 19773 5367332 ~ 5379962 (-)
tpbgb LOC107688980,LOC107725281,LOC107713928,LOC107713927,LOC107689178,LOC107559023 coding upstream 70914 5418473 ~ 5420640 (-)
bckdhb bckdhb,LOC107688983,LOC107689156,LOC107559046,LOC107569448 coding upstream 161058 5508617 ~ 5559896 (-)
G109914 NA non-coding downstream 25109 5247238 ~ 5321296 (-)
LOC122359853 NA non-coding downstream 138986 5198791 ~ 5207419 (-)
G109907 NA non-coding downstream 155055 5190781 ~ 5191350 (-)
G109906 NA non-coding downstream 155700 5190350 ~ 5190705 (-)
G109891 NA non-coding downstream 168870 5177331 ~ 5177535 (-)
G109953 NA non-coding upstream 48571 5396130 ~ 5396354 (-)
G109956 NA non-coding upstream 49738 5397297 ~ 5397517 (-)
G109944 NA non-coding upstream 88273 5435832 ~ 5437067 (-)
LOC122360242 elovl4a,LOC107726252,LOC107689158,LOC107689169,LOC107713923,LOC107688984,LOC107559048 non-coding upstream 228081 5575640 ~ 5581732 (-)
G110090 NA non-coding upstream 427288 5774847 ~ 5777041 (-)
vegfaa vegfa,vegfaa,LOC107703930,LOC107559057,LOC107725277,LOC107688978,LOC106605015 other downstream 100847 5232211 ~ 5245558 (-)
G109724 LOC107084717,LOC106511825 other downstream 1250901 4094757 ~ 4095504 (-)
G109600 NA other downstream 2216426 3113842 ~ 3129979 (-)
prdm1a prdm1,prdm1a,LOC107714407,LOC107697283,LOC107551748,LOC107661008,LOC107581686 other downstream 3382244 1741120 ~ 1964161 (-)
G109287 NA other downstream 4463653 882459 ~ 882752 (-)
si:dkey-283b15.2 si:dkey-283b15.2,si:dkey-14o18.2,LOC107688992,LOC107559040,LOC107558638,LOC108410647 other upstream 435108 5782667 ~ 5790534 (-)
ndufa3 ndufa3,LOC107558639,LOC107713918,LOC107559056,LOC107726249 other upstream 469481 5817040 ~ 5818618 (-)
LOC122359839 LOC107689176,LOC107726242,LOC107689019,LOC107559018,LOC107559017,LOC107558630,LOC107713911 other upstream 555018 5902577 ~ 6184133 (-)
G110208 adamts16,LOC107757336,LOC107558631,LOC107689003,LOC107726256,LOC107657842,LOC568792 other upstream 681649 6029208 ~ 6034777 (-)
G110215 NA other upstream 749116 6096675 ~ 6099927 (-)

Expression


Co-expression Network