G110208 (adamts16,LOC107757336,LOC107558631,LOC107689003,LOC107726256,LOC107657842,LOC568792)


Basic Information

Item Value
gene id G110208
gene name adamts16,LOC107757336,LOC107558631,LOC107689003,LOC107726256,LOC107657842,LOC568792
gene type unknown
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056714.1
NCBI id CM032083.1
chromosome length 28146790
location 6029208 ~ 6034777 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU162885
GTCAGGTTTGATCAGAACTCAGGATGCAGATTACTTTCTGAAGCCGTTGCATCTACATCAGGCACTTCTGGAGAACTTCTCAGCCTCACCTGACCACCACCCCCACATCCTATACAAGAGGTCCACACCAGCGCAGACCAGCAGAGACAGGAGGTCAATTGAGCCAAAGACGGTCAGCAGAAGAGATTCAGCAGTCCCGTATCTCTGGACGGATGCAAAGGAGAACCAGCATACTCCGCAGAGACAGCACTTCTGTGGAAGACGGAAGAAATATATGCCTAAACCTCCTGAGGATGATATCTATATTTTCCCGGATGAATATAAGTTCATGCCCAGAGAGAAGCGAGCCATTATGTTCAAACCTCAGACACAGAAGAGGCTAAATGTGGAGACCCTGGTGGTGGTCGACCGCAAGATGATGGACAATCACGGCCATGAGAATATAACCACATATGTGCTTACTGTTCTTAACATGGTCTCAACACTTTTCAAAGATGGCACTATTGGAGGTGATATCAATGTTGTAATTGTTGGACTAATACTGCTGGATGAAGACCAGGATGGACTAGTGATTAACCATCATGCGGATCACACTCTGAACAGTTTCTGCCAGTGGCAGTCAGGGCTGGCTGGAAGAGAAGGTCGCCGCCATGATCATGCCATCCTGCTAACTGGTCTGGATATCTGCTCCTGGAAGAACGAACCATGTGACACCCTGGGCTTTGCTCCAATCAGTGGGATGTGTAGTAAGTACCGCAGCTGTACGATCAATGAGGACACGGGTCTCGGTCTGGCCTTCACCATCGCCCATGAATCTGGCCACAACTTTGGAATGGTCCATGAT

Function

symbol description
adamts16 Predicted to enable metal ion binding activity and metalloendopeptidase activity. Acts upstream of or within basement membrane disassembly and closure of optic fissure. Predicted to be located in extracellular region. Is expressed in several structures, including digestive system; eye; muscle; optic cup; and pleuroperitoneal region. Used to study coloboma.

NR:

description
PREDICTED: A disintegrin and metalloproteinase with thrombospondin motifs 16-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU162885 True 844 TUCP 0.49 6 6029208 6034777

Neighbor

gene id symbol gene type direction distance location
celf3b LOC107559029,LOC107713913,LOC107689166 coding downstream 128991 5877048 ~ 5900217 (-)
cers2b cers2b,LOC107688996,LOC107726244,LOC107689165,LOC107558627 coding downstream 156150 5853476 ~ 5873058 (-)
arnt arnt,LOC107688995,LOC107689175,LOC107559034 coding downstream 178994 5834157 ~ 5850214 (-)
mrpl51 mrpl51,LOC107726236,LOC107713917,LOC107559052 coding downstream 206358 5820991 ~ 5822850 (-)
dctn3 dctn3,LOC107713912,LOC107559051,LOC107689179,LOC107726235,LOC107689028,LOC107569444 coding downstream 455408 5571501 ~ 5573800 (-)
tars2 LOC107558643,LOC107689001,LOC107726246 coding upstream 214142 6248919 ~ 6261997 (-)
rprd2b LOC107757337,LOC107558642,LOC107689000,LOC107689168,LOC107559016,LOC107726232 coding upstream 228727 6263504 ~ 6279577 (-)
irx1a irx1a,LOC107758835,LOC107558645,LOC107726233,LOC107554507 coding upstream 527073 6561850 ~ 6566189 (-)
LOC122360792 NA coding upstream 616172 6650949 ~ 6690226 (-)
sox4b sox4,LOC107732138,LOC107722246 coding upstream 1353939 7388716 ~ 7392318 (-)
G110206 NA non-coding downstream 29847 5997621 ~ 5999361 (-)
G110106 NA non-coding downstream 176446 5852432 ~ 5852762 (-)
G110102 NA non-coding downstream 212335 5815560 ~ 5816873 (-)
G110100 LOC107713901,LOC107689161,LOC107559047,LOC107689017 non-coding downstream 215524 5809971 ~ 5813684 (-)
G110093 NA non-coding downstream 220859 5778754 ~ 5808349 (-)
G110221 NA non-coding upstream 84008 6118785 ~ 6119767 (-)
G110224 NA non-coding upstream 102330 6137107 ~ 6207805 (-)
G110227 NA non-coding upstream 104617 6139394 ~ 6208668 (-)
G110216 NA non-coding upstream 105762 6140539 ~ 6141321 (-)
G110217 NA non-coding upstream 107227 6142004 ~ 6142840 (-)
ndufa3 ndufa3,LOC107558639,LOC107713918,LOC107559056,LOC107726249 other downstream 210590 5817040 ~ 5818618 (-)
si:dkey-283b15.2 si:dkey-283b15.2,si:dkey-14o18.2,LOC107688992,LOC107559040,LOC107558638,LOC108410647 other downstream 238674 5782667 ~ 5790534 (-)
vegfaa vegfa,vegfaa,LOC107703930,LOC107559057,LOC107725277,LOC107688978,LOC106605015 other downstream 783650 5232211 ~ 5245558 (-)
G109724 LOC107084717,LOC106511825 other downstream 1933704 4094757 ~ 4095504 (-)
G109600 NA other downstream 2899229 3113842 ~ 3129979 (-)
G110215 NA other upstream 61898 6096675 ~ 6099927 (-)
LOC122359836 adamts16,LOC107757336,LOC107726256,LOC107689003,LOC107657842 other upstream 244932 6279709 ~ 6339496 (-)
G110303 NA other upstream 1047185 7081962 ~ 7083524 (-)
LOC122360222 nrsn1,LOC107730905,LOC107758834,LOC107558647,LOC107663792 other upstream 1160713 7195490 ~ 7201381 (-)
cdkal1 cdkal1,LOC107722243,LOC107732137,LOC107663002 other upstream 1407121 7441898 ~ 7618596 (-)

Expression


Co-expression Network