G111807 (si:ch211-257p13.3,LOC107752836,LOC107581541,LOC107685558,LOC107596636,LOC107673049,LOC107743172)


Basic Information

Item Value
gene id G111807
gene name si:ch211-257p13.3,LOC107752836,LOC107581541,LOC107685558,LOC107596636,LOC107673049,LOC107743172
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056714.1
NCBI id CM032083.1
chromosome length 28146790
location 12480724 ~ 12480975 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU165034
CATTTTCAGACGATGGGCTCTGCTGCTGAGCGATCACATCCTCCAGGCTGTTAATCACACTGTTCTTGTCTCTGAGGCGCTGGCGGTAGGAGGCACGCAGGGCCTTCATTTTCCTCCGGTGCTGGACGCGGTGTCTGCGCAGCTGCAGACGGTACTGATCCGCCTGCTGCTGCAGCTGTTGCAGGTGAGAATATTGCTCCAGGAAACTCAGGAGGTGTGACATCACGGACAGCAATGGAGACTCTGTCACCT

Function

symbol description
si:ch211-257p13.3 Predicted to enable ATP binding activity; microtubule binding activity; and microtubule motor activity. Predicted to act upstream of or within microtubule-based movement. Predicted to be located in microtubule. Orthologous to human KIFC2 (kinesin family member C2).

NR:

description
PREDICTED: kinesin-like protein KIFC3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU165034 True 252 lncRNA 0.57 1 12480724 12480975

Neighbor

gene id symbol gene type direction distance location
LOC122360109 NA coding downstream 58605 12419118 ~ 12422119 (-)
LOC122360649 NA coding downstream 83474 12392767 ~ 12397250 (-)
slc6a19b slc6a19b,LOC107743232,LOC107662664,LOC107685553,LOC107596751,LOC105905464 coding downstream 253775 12216856 ~ 12226949 (-)
si:ch211-254p10.2 LOC107685554,LOC107596717,LOC107752844,LOC102209663 coding downstream 266375 12208105 ~ 12214349 (-)
rapgef5b LOC107596719,LOC107685551,LOC107581543,LOC107728526,LOC107674937,LOC107743169 coding downstream 277636 12155770 ~ 12203088 (-)
ccdc12 ccdc12,LOC107743233,LOC107752847,LOC107581540 coding upstream 10523 12491498 ~ 12497557 (-)
setd2 LOC107743179,LOC107685560,LOC107752833,LOC107673014,LOC107581536,LOC107596709 coding upstream 96886 12577861 ~ 12599994 (-)
LOC122361014 mtbp,LOC107596625,LOC107685571,LOC107707175,LOC107673040 coding upstream 325253 12806228 ~ 12825561 (-)
col14a1a col14a1a,LOC107685600,LOC107707159,LOC107672958 coding upstream 358086 12839061 ~ 12944070 (-)
deptor deptor,LOC107685573,LOC107673035,LOC107596624,LOC107743215 coding upstream 466975 12947950 ~ 12975794 (-)
G111806 NA non-coding downstream 936 12479434 ~ 12479788 (-)
G111791 NA non-coding downstream 38111 12441953 ~ 12442613 (-)
G111789 LOC107662667,LOC107752837,LOC107581613,LOC107581612 non-coding downstream 39850 12439786 ~ 12440874 (-)
G111788 NA non-coding downstream 41071 12437425 ~ 12439653 (-)
G111716 NA non-coding downstream 329847 12150542 ~ 12150877 (-)
G111809 NA non-coding upstream 5876 12486851 ~ 12487693 (-)
G111799 NA non-coding upstream 8807 12489782 ~ 12490120 (-)
G111860 NA non-coding upstream 76836 12557811 ~ 12611994 (-)
G111862 NA non-coding upstream 86230 12567205 ~ 12652406 (-)
G112229 NA non-coding upstream 543958 13024933 ~ 13026129 (-)
rxrbb rxrbb,rxrba,LOC107596638,LOC107581542,LOC107752838,LOC107743171,LOC107566635 other downstream 102275 12363785 ~ 12378449 (-)
LOC122361049 c16h2orf66,LOC107743229 other downstream 613409 11865680 ~ 11867315 (-)
G111490 si:dkey-12j5.1,LOC107738871,LOC107549224,LOC107689883,LOC107717803,LOC108256403,LOC108426361,LOC107593733 other downstream 1068947 11410678 ~ 11411777 (-)
LOC122360600 enpp2,LOC107757440,LOC107745056,LOC107697648,LOC107574906,LOC107681346 other downstream 1093731 11333175 ~ 11386993 (-)
G111450 mal2,LOC107757438,LOC107571097,LOC107677950,LOC107738940 other downstream 1194292 11269620 ~ 11286432 (-)
zgc:92606 zgc:92606,LOC107724707,LOC107549485,LOC107598403,LOC107672985,LOC107744286,LOC108432344 other upstream 1173085 13654060 ~ 13683909 (-)
G112478 NA other upstream 1753579 14234554 ~ 14301619 (-)
dicp3.3 NA other upstream 2017288 14498263 ~ 14503136 (-)
LOC122359961 riiad1 other upstream 2101504 14582479 ~ 14587869 (-)
si:ch211-105c13.3 si:ch211-105c13.3,LOC107673711,LOC107594941,LOC107582067,LOC107677027,LOC107735771 other upstream 2418207 14899182 ~ 14904907 (-)

Expression


Co-expression Network