G9101



Basic Information


Item Value
gene id G9101
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 13965556 ~ 13965763 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU10030
AGGCAAGTATCGTTCTCCTGGCAACCACCAAACCCAGACTCGTCCATCGGATTGCCAGACAGAGAAGCGTGATTCGTCACTCCAGAGAACACATCTCCACTGCTCTAGAGTCCAGTGGCGGCGTGCTTTACACCACTGCATCCGACGCTTTGCATTATACTTGGTGATGTAAAGCTTGGATGCAGCTGCTCGGCCATGGAAACCCATT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU10030 True 208 lncRNA 0.52 1 13965556 13965763

Neighbor


gene id symbol gene type direction distance location
CI01000000_13941671_13945038 ASAH1A coding downstream 20094 13941099 ~ 13945462 (-)
CI01000000_13937628_13939186 FGL1 coding downstream 26370 13937167 ~ 13939186 (-)
CI01000000_13906139_13911457 NA coding downstream 53416 13905955 ~ 13912140 (-)
CI01000000_13865446_13896796 RNF130 coding downstream 68760 13864272 ~ 13896796 (-)
CI01000000_13857002_13862576 NA coding downstream 102980 13856991 ~ 13862576 (-)
CI01000000_14084856_14094385 CYP4V7 coding upstream 119007 14084770 ~ 14094385 (-)
CI01000000_14096753_14113883 NA coding upstream 129909 14095672 ~ 14113883 (-)
CI01000000_14191335_14195457 NA coding upstream 225544 14191307 ~ 14195669 (-)
CI01000000_14195942_14196532 NA coding upstream 230064 14195808 ~ 14196534 (-)
CI01000000_14200000_14436182 TENM2 coding upstream 234237 14200000 ~ 14436253 (-)
G9099 NA non-coding downstream 1798 13963483 ~ 13963758 (-)
G9098 NA non-coding downstream 2143 13963184 ~ 13963413 (-)
G9094 NA non-coding downstream 34943 13929160 ~ 13930613 (-)
G9091 NA non-coding downstream 37004 13926562 ~ 13928552 (-)
G9082 NA non-coding downstream 118088 13846803 ~ 13847468 (-)
G9135 NA non-coding upstream 69179 14034942 ~ 14035182 (-)
G9136 NA non-coding upstream 69482 14035245 ~ 14035575 (-)
G9647 NA non-coding upstream 165248 14131011 ~ 14137401 (-)
G9794 NA non-coding upstream 733948 14699711 ~ 14699932 (-)
G9036 NA other downstream 238466 13726800 ~ 13727090 (-)
G8699 NA other downstream 654127 13272585 ~ 13311429 (-)
G8125 NA other downstream 2924647 11040269 ~ 11040909 (-)
CI01000000_10824957_10825464 MMGT1, TMM32 other downstream 3137961 10824324 ~ 10825464 (-)
CI01000000_10407402_10409508 UBL3B, UBL3.S, UBL3 other downstream 3551043 10407395 ~ 10409950 (-)
G9602 NA other upstream 375239 14341002 ~ 14346534 (-)
G10672 NA other upstream 2260524 16226287 ~ 16231126 (-)
CI01000000_16354158_16360016 NA other upstream 2396745 16353959 ~ 16360213 (-)
G11107 NA other upstream 2701355 16667118 ~ 16667947 (-)

Expression



Co-expression Network