G8920


Basic Information

Item Value
gene id G8920
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 13968497 ~ 13968881 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU9824
CTACACTGTAAAAAATGAATGTGATTTTAACAGTAAAATATTGTAAAAACGCTACGGAAAAAAATTGTAAATAGGTTAACAGTAAGTTCCAGTACTATATACAGGGAAAAACTGTAAAAGCTCTTACCAGACATTTTATGTAATTTTCACAGTAAAATGCTGTAAATTTTACAATTTTTAGAAGTAAAAAAGAACAAATCAATGTATAATTTACAGTCAAAAATGAATGTTTATTGCATTATGTAAGTGTTGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU9824 True 254 lncRNA 0.36 2 13968497 13968881

Neighbor

gene id symbol gene type direction distance location
CI01000000_13934872_13936612 NA coding upstream 31550 13934872 ~ 13936947 (+)
CI01000000_13926605_13928231 LECT2L coding upstream 40156 13926519 ~ 13928341 (+)
CI01000000_13923608_13925296 NA coding upstream 42917 13923608 ~ 13925580 (+)
CI01000000_13917448_13919323 NA coding upstream 48653 13917318 ~ 13919844 (+)
CI01000000_13849975_13855802 TDO2A coding upstream 112250 13849975 ~ 13856247 (+)
CI01000000_13971301_14008905 FAT1B coding downstream 1506 13970387 ~ 14010358 (+)
CI01000000_14018908_14032529 MTNR1AA, MTNR1AB, MTNR1A coding downstream 50027 14018908 ~ 14032529 (+)
CI01000000_14143399_14175045 NA coding downstream 174518 14127685 ~ 14175354 (+)
CI01000000_14178546_14189186 NA coding downstream 209482 14178363 ~ 14189331 (+)
CI01000000_14718151_14741998 NA coding downstream 748924 14717805 ~ 14742191 (+)
G8918 NA non-coding upstream 2722 13965446 ~ 13965775 (+)
G8912 NA non-coding upstream 25801 13942384 ~ 13942696 (+)
G8909 NA non-coding upstream 44186 13924088 ~ 13924311 (+)
G8906 NA non-coding upstream 51792 13916367 ~ 13916705 (+)
G8905 NA non-coding upstream 52273 13915859 ~ 13916224 (+)
G9159 NA non-coding downstream 113211 14082092 ~ 14082518 (+)
G9168 NA non-coding downstream 136258 14105139 ~ 14108116 (+)
G9195 NA non-coding downstream 242407 14211288 ~ 14212651 (+)
G9201 NA non-coding downstream 246143 14215024 ~ 14234941 (+)
G7522 NA other upstream 1789489 12178369 ~ 12179008 (+)
G7514 NA other upstream 1831489 12136522 ~ 12137008 (+)
G7153 NA other upstream 2722864 11244457 ~ 11245633 (+)
G7018 NA other upstream 2987625 10978489 ~ 10980872 (+)
G6820 NA other upstream 3535479 10427223 ~ 10433018 (+)
G10201 NA other downstream 1961385 15930266 ~ 15930562 (+)
CI01000000_17339270_17345013 CXCL14, CXL14 other downstream 3370273 17339154 ~ 17346200 (+)
G11465 NA other downstream 3915072 17883953 ~ 17887462 (+)
G11521 NA other downstream 4063858 18032739 ~ 18164112 (+)

Expression


Co-expression Network