G10201


Basic Information

Item Value
gene id G10201
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 15930266 ~ 15930562 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU11228
GCTTTCTCCAAAAACACTGTTAAATGGGTGTGGAGTCCCCCTTCAGATTCACACTGAAGGAGTCTGCTTTCAAAGACACACTAGAGGATCCTTTTGAAGAGCAAGCAGCCCGAGGTTACTCATCCATGGACTCAATGAATCCTTTCAGAGTGGGGTACTCATACACAGACAGACTCAACAATAAGTGTTTGCTCACAAGAGGGTGCCCAGTGCAAGAAGACCGAGCTGTGTCATCACTCCACAACTGTCCATCATCTCAAGGTGATTCAACAGCCCAAAATTTGAGACTGGTGAAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU11228 True 297 TUCP 0.35 1 15930266 15930562

Neighbor

gene id symbol gene type direction distance location
CI01000000_15893372_15894283 NEUROG1 coding upstream 35373 15891679 ~ 15894893 (+)
CI01000000_15684820_15696865 NA coding upstream 233151 15684495 ~ 15697115 (+)
CI01000000_15620007_15622711 PCDH11X coding upstream 307424 15620007 ~ 15622842 (+)
CI01000000_15519933_15528742 PCDH11X, PCDH11 coding upstream 401371 15519933 ~ 15528895 (+)
CI01000000_15158265_15165627 NA coding upstream 763994 15157022 ~ 15166585 (+)
CI01000000_15964514_15964804 NA coding downstream 33765 15964327 ~ 15964961 (+)
CI01000000_16011590_16014992 NA coding downstream 81028 16011590 ~ 16015151 (+)
CI01000000_16034357_16056363 SMAD5 coding downstream 103336 16033898 ~ 16056594 (+)
CI01000000_16066787_16081915 LMAN2 coding downstream 135747 16066309 ~ 16082483 (+)
CI01000000_16087757_16091758 TMED9 coding downstream 156871 16087433 ~ 16092035 (+)
G10200 NA non-coding upstream 302 15929668 ~ 15929964 (+)
G10052 NA non-coding upstream 48744 15872401 ~ 15881522 (+)
G10080 NA non-coding upstream 146748 15783238 ~ 15783518 (+)
G10153 NA non-coding upstream 150131 15779913 ~ 15780135 (+)
G10149 NA non-coding upstream 153349 15776574 ~ 15776917 (+)
G10203 NA non-coding downstream 698 15931260 ~ 15931467 (+)
G10185 NA non-coding downstream 2422 15932984 ~ 15933376 (+)
G10209 NA non-coding downstream 23237 15953799 ~ 15954449 (+)
G10240 NA non-coding downstream 70290 16000852 ~ 16001649 (+)
G10255 NA non-coding downstream 83279 16013841 ~ 16014082 (+)
G9201 NA other upstream 1695325 14215024 ~ 14234941 (+)
G7522 NA other upstream 3751258 12178369 ~ 12179008 (+)
G7514 NA other upstream 3793258 12136522 ~ 12137008 (+)
G7153 NA other upstream 4684633 11244457 ~ 11245633 (+)
G7018 NA other upstream 4949394 10978489 ~ 10980872 (+)
CI01000000_17339270_17345013 CXCL14, CXL14 other downstream 1408592 17339154 ~ 17346200 (+)
G11465 NA other downstream 1953391 17883953 ~ 17887462 (+)
G11521 NA other downstream 2102177 18032739 ~ 18164112 (+)
G11801 NA other downstream 2750305 18674116 ~ 18745376 (+)

Expression


Co-expression Network