LOC122360352 (zgc:91890,LOC107559041,LOC107689180,LOC107688990,LOC107713919,LOC107726234)


Basic Information

Item Value
gene id LOC122360352
gene name zgc:91890,LOC107559041,LOC107689180,LOC107688990,LOC107713919,LOC107726234
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056714.1
NCBI id CM032083.1
chromosome length 28146790
location 4159487 ~ 4160521 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043260881.1
ATGTCACTGTTCACACACTTGTTGGCCTGTCTCTTTGGCATCGGATCATGGGTGGCCATTAACGGGATGTGGGTGGAGCTGCCTCTGATCGTCCCCTCTATTCCGGAGGGGTGGTACCTGCCCTCCTACCTCACTATCATTATCCAGATGGCTAACATCGGGCCTCTCTTCATCACGCTCATGCACCGTTTCAGACCGGGCATGCTGGACGAGCGGCCTGTTATCTACACCATCGTGACGGTCGGTCTGGTGGCCACCTTCCTCCTGGCCTTCTTCTGGAACCACACGCTTTCTTTTGGAGGAGGCAAACATAGCGCTGCCCTACTGTCCCTCAGCTTCCTGCTGTCTGTGGTAGACTGCACCTCGTCTGTTACCTTTCTACCCTTCATGATGCGTCTACAGCCTCGGTACCTCACCACCTACTTCATTGGAGAGGGTCTAAGTGGCCTGGTCCCAGCACTGGTGGCTCTTATCCAAGGCGTAGGGGTGATCCACTGCAAAAATGCCAGTGCTAATGCAAACTTTAGCATGGGGAACTCATCCTGGGGCTTCGATGGAGCACTTCAGGAACAATATCAACCAGCCAACTTCTCTGCTCAGGGTTTCTTCCTGTTCCTCAGTGCGATGATGTTCGTGTGCCTGGGAGCTTTCTTGTTACTCAACTTCCACCCAGCTGTGGTGCGGGAACACAAGAGCAAATGTTATACTGATGATTCTCAGCAAGTGGAGAAGATTGATATGAGCCAGTCCCCAAATAATGAAGCTCCAGAACAAAAGCCCATGCTGGATTTCACAGAAGGACCTGTTTTAAAGCGACACAGTTCGTTTGGAAAAGGAACCTACAGCAGAATGCAGCTGGTCTTCATATTTGTAGTTCTGGCCTGGGTAAACGCACTGACCAATGCAGTCTTGCCCTCAGTCCAGCCTTACTCCTGTTTGCCATATGGAAATCAGGCCTATCATCTTGCAGCCACTTTGTCTTCGGTAGCCAATCCGGTGGCTTGCTTCATTGCCATGTTTGTGCCAATCAGGTGA

Function

symbol description
zgc:91890 Predicted to enable riboflavin transmembrane transporter activity. Predicted to be involved in riboflavin transport. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Predicted to be integral component of plasma membrane. Is expressed in several structures, including alar plate midbrain region; epidermis; immature eye; midbrain; and pectoral fin. Human ortholog(s) of this gene implicated in Brown-Vialetto-Van Laere syndrome 1 and Fazio-Londe disease. Orthologous to human SLC52A3 (solute carrier family 52 member 3).

NR:

description
PREDICTED: solute carrier family 52, riboflavin transporter, member 3-B

GO:

id name namespace
GO:0006810 transport biological_process
GO:0005886 plasma membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043260881.1 True 1035 mRNA 0.51 1 4159487 4160521

Neighbor

gene id symbol gene type direction distance location
csf3r NA coding downstream 415875 3729142 ~ 3743612 (-)
hace1 hace1,LOC107679309,LOC107661011,LOC107598938 coding downstream 460417 3684118 ~ 3699070 (-)
ascc3 ascc3 coding downstream 1094909 2915655 ~ 3064578 (-)
sim1a sim1a,sim1,LOC107697271,LOC107661021,LOC107551726 coding downstream 1244056 2899313 ~ 2915431 (-)
LOC122360106 NA coding downstream 1458538 2700321 ~ 2700949 (-)
LOC122360353 LOC107713904,LOC107689171,LOC107559021,LOC107688989 coding upstream 43160 4203681 ~ 4243342 (-)
LOC122360932 grik3,LOC100334689,LOC105019312,LOC106605119,LOC102778608 coding upstream 351453 4511974 ~ 4614017 (-)
LOC122360926 LOC107598923,LOC107756920,LOC107732735,LOC107660307,LOC107565651 coding upstream 635289 4795810 ~ 4799825 (-)
smpdl3b smpdl3b,LOC107744599,LOC107703919,LOC107732739,LOC107688972 coding upstream 728962 4889483 ~ 4894107 (-)
limd1a LOC107703922,LOC107744601,LOC107598949,LOC106579350,LOC107732724,LOC107688969,LOC107756905,LOC106605519,LOC107562399 coding upstream 745336 4905857 ~ 4929011 (-)
G109729 si:dkey-283b15.4,LOC108410633,LOC107558621,LOC107559044,LOC107726254,LOC107688991,LOC108268159 non-coding downstream 3775 4153717 ~ 4155712 (-)
G109716 NA non-coding downstream 217848 3940957 ~ 3941639 (-)
G109650 NA non-coding downstream 267664 3891138 ~ 3891823 (-)
G109638 NA non-coding downstream 442404 3709267 ~ 3717083 (-)
G109615 NA non-coding downstream 530070 3628808 ~ 3629417 (-)
LOC122360497 NA non-coding upstream 19886 4180407 ~ 4181293 (-)
G109743 NA non-coding upstream 226880 4387401 ~ 4387701 (-)
G109760 NA non-coding upstream 652798 4813319 ~ 4814496 (-)
G109819 NA non-coding upstream 658286 4818807 ~ 4819736 (-)
G109820 NA non-coding upstream 661034 4821555 ~ 4822686 (-)
G109724 LOC107084717,LOC106511825 other downstream 63983 4094757 ~ 4095504 (-)
G109600 NA other downstream 1029508 3113842 ~ 3129979 (-)
prdm1a prdm1,prdm1a,LOC107714407,LOC107697283,LOC107551748,LOC107661008,LOC107581686 other downstream 2195326 1741120 ~ 1964161 (-)
G109287 NA other downstream 3276735 882459 ~ 882752 (-)
G109275 NA other downstream 3526590 632465 ~ 632897 (-)
vegfaa vegfa,vegfaa,LOC107703930,LOC107559057,LOC107725277,LOC107688978,LOC106605015 other upstream 1071690 5232211 ~ 5245558 (-)
si:dkey-283b15.2 si:dkey-283b15.2,si:dkey-14o18.2,LOC107688992,LOC107559040,LOC107558638,LOC108410647 other upstream 1622146 5782667 ~ 5790534 (-)
ndufa3 ndufa3,LOC107558639,LOC107713918,LOC107559056,LOC107726249 other upstream 1656519 5817040 ~ 5818618 (-)
LOC122359839 LOC107689176,LOC107726242,LOC107689019,LOC107559018,LOC107559017,LOC107558630,LOC107713911 other upstream 1742056 5902577 ~ 6184133 (-)
G110208 adamts16,LOC107757336,LOC107558631,LOC107689003,LOC107726256,LOC107657842,LOC568792 other upstream 1868687 6029208 ~ 6034777 (-)

Expression


Co-expression Network