G10358


Basic Information

Item Value
gene id G10358
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 16354572 ~ 16354832 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU11410
TCAGACTGGATTTTTTTTTAGAAGATTCAACCATTTGACACTCACGCTCAAAAAATCTGTGCTGCCAATCTGAAATACATGCTACAGTCAGCCACGCTGATCATACATGCTCTTTAGGATCATAAATGAGTTTAGGAGTGAATCACGTAATGGCATGTCTATGCAGAAATCACTTCTGAGTAAACACCAGAGAAGTTTCTAGACCAGGTCTTTCTGCGCAGATGAAGCATATAAAAGAATCTTACATAAACATTGTGGCAA

Function

NR:

description
PREDICTED: serine/threonine-protein phosphatase PP1-gamma catalytic subunit B-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU11410 True 261 lncRNA 0.40 1 16354572 16354832

Neighbor

gene id symbol gene type direction distance location
CI01000000_16339900_16340277 ATOX1 coding upstream 14191 16339900 ~ 16340381 (+)
CI01000000_16282545_16293288 MTNR1AL coding upstream 59907 16282126 ~ 16294665 (+)
CI01000000_16226281_16275284 FAT2 coding upstream 79095 16226281 ~ 16275477 (+)
CI01000000_16142079_16144991 NA coding upstream 209293 16142079 ~ 16145279 (+)
CI01000000_16106717_16114328 EMX1.2, EMX3, EMX1 coding upstream 240217 16106598 ~ 16114355 (+)
CI01000000_16362843_16368520 SPARC coding downstream 7859 16362691 ~ 16368520 (+)
CI01000000_16375958_16382103 G3BP1 coding downstream 19126 16373958 ~ 16382558 (+)
CI01000000_16468276_16479177 NA coding downstream 112657 16467489 ~ 16481059 (+)
CI01000000_16573665_16580545 SLC25A48 coding downstream 218833 16573665 ~ 16580958 (+)
CI01000000_16611284_16612778 CPLX2, CPLX1 coding downstream 256452 16611284 ~ 16613885 (+)
G10357 NA non-coding upstream 718 16353638 ~ 16353854 (+)
G10356 NA non-coding upstream 965 16353404 ~ 16353607 (+)
G10355 NA non-coding upstream 1877 16352414 ~ 16352695 (+)
G10354 NA non-coding upstream 2404 16351855 ~ 16352168 (+)
G10353 NA non-coding upstream 3365 16350948 ~ 16351207 (+)
G10359 NA non-coding downstream 60 16354892 ~ 16355198 (+)
G10360 NA non-coding downstream 901 16355733 ~ 16355938 (+)
G10364 NA non-coding downstream 31510 16386342 ~ 16386725 (+)
G10380 NA non-coding downstream 68526 16423358 ~ 16427175 (+)
G10869 NA non-coding downstream 169753 16524585 ~ 16524785 (+)
G10201 NA other upstream 424010 15930266 ~ 15930562 (+)
G9201 NA other upstream 2119631 14215024 ~ 14234941 (+)
G7522 NA other upstream 4175564 12178369 ~ 12179008 (+)
G7514 NA other upstream 4217564 12136522 ~ 12137008 (+)
G7153 NA other upstream 5108939 11244457 ~ 11245633 (+)
CI01000000_17339270_17345013 CXCL14, CXL14 other downstream 984322 17339154 ~ 17346200 (+)
G11465 NA other downstream 1529121 17883953 ~ 17887462 (+)
G11521 NA other downstream 1677907 18032739 ~ 18164112 (+)
G11801 NA other downstream 2326035 18674116 ~ 18745376 (+)

Expression


Co-expression Network