G10380


Basic Information

Item Value
gene id G10380
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 16423358 ~ 16427175 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU11441
CTTATACTGTACAAAACATTCCCGTTTTTGGAGATCCTCAAAAGCTTGTTGTCAGTGGTAACCTCATGGAAATTAGCTCCCTTTTCATTGGCAAAGAACAGATCGGGTTTCCAAATGGAGTCCAACATGGAGGGATCAAGGTCAAGAGAGTCATCGGGATATTCGCTGTAGGCCAGCCGAGGGTCATTCCACTGCTGTCTCAGAAAAATGTTCACTCTGTAATCCATTGTTGTTTCAGCAATAGATCCAAAACTGTTAATAAAAATGTTGCATGTTACGTTCACA

Function

NR:

description
PREDICTED: up-regulated during skeletal muscle growth protein 5

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU11441 True 285 lncRNA 0.45 2 16423358 16427175

Neighbor

gene id symbol gene type direction distance location
CI01000000_16375958_16382103 G3BP1 coding upstream 40800 16373958 ~ 16382558 (+)
CI01000000_16362843_16368520 SPARC coding upstream 54838 16362691 ~ 16368520 (+)
CI01000000_16339900_16340277 ATOX1 coding upstream 82977 16339900 ~ 16340381 (+)
CI01000000_16282545_16293288 MTNR1AL coding upstream 128693 16282126 ~ 16294665 (+)
CI01000000_16226281_16275284 FAT2 coding upstream 147881 16226281 ~ 16275477 (+)
CI01000000_16468276_16479177 NA coding downstream 40314 16467489 ~ 16481059 (+)
CI01000000_16573665_16580545 SLC25A48 coding downstream 146490 16573665 ~ 16580958 (+)
CI01000000_16611284_16612778 CPLX2, CPLX1 coding downstream 184109 16611284 ~ 16613885 (+)
CI01000000_16676128_16679215 SLC26A2 coding downstream 248861 16676036 ~ 16679240 (+)
CI01000000_16781396_16802242 HTR4 coding downstream 354221 16781396 ~ 16802418 (+)
G10364 NA non-coding upstream 36633 16386342 ~ 16386725 (+)
G10360 NA non-coding upstream 67420 16355733 ~ 16355938 (+)
G10359 NA non-coding upstream 68160 16354892 ~ 16355198 (+)
G10358 NA non-coding upstream 68526 16354572 ~ 16354832 (+)
G10357 NA non-coding upstream 69504 16353638 ~ 16353854 (+)
G10869 NA non-coding downstream 97410 16524585 ~ 16524785 (+)
G10878 NA non-coding downstream 108093 16535268 ~ 16535522 (+)
G10879 NA non-coding downstream 108456 16535631 ~ 16535977 (+)
G10891 NA non-coding downstream 128951 16556126 ~ 16556496 (+)
G10893 NA non-coding downstream 132040 16559215 ~ 16559484 (+)
G10201 NA other upstream 492796 15930266 ~ 15930562 (+)
G9201 NA other upstream 2188417 14215024 ~ 14234941 (+)
G7522 NA other upstream 4244350 12178369 ~ 12179008 (+)
G7514 NA other upstream 4286350 12136522 ~ 12137008 (+)
G7153 NA other upstream 5177725 11244457 ~ 11245633 (+)
CI01000000_17339270_17345013 CXCL14, CXL14 other downstream 911979 17339154 ~ 17346200 (+)
G11465 NA other downstream 1456778 17883953 ~ 17887462 (+)
G11521 NA other downstream 1605564 18032739 ~ 18164112 (+)
G11801 NA other downstream 2253692 18674116 ~ 18745376 (+)

Expression


Co-expression Network