LOC122361209



Basic Information


Item Value
gene id LOC122361209
gene name NA
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_056714.1
NCBI id CM032083.1
chromosome length 28146790
location 252387 ~ 252505 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence


>XR_006252906.1
acttacggccataccaccctgttcacgcctgatctcgtctgatctcagaagctaagcagagttgggcctagttagtacttggatgggagactgcctaggaataccaggtgctgtaagtt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_006252906.1 True 119 rRNA 0.50 1 252387 252505
Loading

Neighbor


gene id symbol gene type direction distance location
LOC122361198 NA coding downstream 281 251988 ~ 252106 (-)
LOC122361150 NA coding downstream 676 251593 ~ 251711 (-)
LOC122361149 NA coding downstream 1468 250801 ~ 250919 (-)
LOC122361148 NA coding downstream 1867 250402 ~ 250520 (-)
LOC122361147 NA coding downstream 2263 250006 ~ 250124 (-)
LOC122361152 NA coding upstream 281 252786 ~ 252904 (-)
LOC122361153 NA coding upstream 688 253193 ~ 253311 (-)
LOC122361221 NA coding upstream 1085 253590 ~ 253708 (-)
LOC122361154 NA coding upstream 1486 253991 ~ 254109 (-)
LOC122361155 NA coding upstream 2279 254784 ~ 254902 (-)
LOC122361262 NA non-coding downstream 61874 190395 ~ 190513 (-)
LOC122361244 NA non-coding downstream 71645 180624 ~ 180742 (-)
LOC122361393 NA non-coding downstream 75974 176295 ~ 176413 (-)
LOC122361392 NA non-coding downstream 86995 165274 ~ 165392 (-)
LOC122361391 NA non-coding downstream 88173 164096 ~ 164214 (-)
G109218 NA non-coding upstream 90366 342871 ~ 352044 (-)
G109248 NA non-coding upstream 197789 450294 ~ 450508 (-)
LOC122360679 NA non-coding upstream 329828 582333 ~ 585503 (-)
G109273 NA non-coding upstream 355575 608080 ~ 608431 (-)
G109276 NA non-coding upstream 407463 659968 ~ 660352 (-)
G109275 NA other upstream 379960 632465 ~ 632897 (-)
G109287 NA other upstream 629954 882459 ~ 882752 (-)
prdm1a prdm1,prdm1a,LOC107714407,LOC107697283,LOC107551748,LOC107661008,LOC107581686 other upstream 1488615 1741120 ~ 1964161 (-)
G109600 NA other upstream 2861337 3113842 ~ 3129979 (-)
G109724 LOC107084717,LOC106511825 other upstream 3842252 4094757 ~ 4095504 (-)

Expression


LOC122361209 Expression in all Baseline Samples

Bar chart with 10 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network