LOC122361375


Basic Information

Item Value
gene id LOC122361375
gene name NA
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056714.1
NCBI id CM032083.1
chromosome length 28146790
location 8647414 ~ 8647555 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XR_006252934.1
CTTCCTGTTTTAGTACCACCCACCTGCTTCCTCACAAGGTGTGTGGCTATGCTAACAGGATAGAGGAACTGTCTGTCAAGATCTGAAGGGGCGGATGGCCACACCTCCTCCACCTCTATATGAATTGGCAGTACATCCTGTA

Function

GO: NA

KEGG:

id description
ko04975 Fat digestion and absorption
ko04979 Cholesterol metabolism
ko04977 Vitamin digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
XR_006252934.1 True 142 snoRNA 0.50 1 8647414 8647555

Neighbor

gene id symbol gene type direction distance location
gapdh gapdh,LOC107596669 coding downstream 17236 8625617 ~ 8630178 (-)
opn9 LOC107685604,LOC107699923,LOC107596762,LOC107550785,LOC107744717 coding downstream 21895 8617631 ~ 8625519 (-)
iffo1b iffo1b,LOC107685521,LOC107596667,LOC107748876,LOC107550819,LOC107744683,LOC107699931 coding downstream 30173 8600708 ~ 8617241 (-)
si:dkey-260g12.1 NA coding downstream 47285 8592235 ~ 8600129 (-)
tnfrsf1a LOC107685522,LOC107748890,LOC107596732 coding downstream 67145 8574027 ~ 8580269 (-)
emg1 emg1,LOC107748869,LOC107748863,LOC107699927,LOC107744679 coding upstream 4401 8651956 ~ 8653563 (-)
kel LOC107569991,LOC107744677,LOC107699936 coding upstream 6278 8653833 ~ 8664175 (-)
zyx zyx,LOC107748852,LOC107569995,LOC107699937,LOC107596670 coding upstream 17011 8664566 ~ 8680965 (-)
clcn1b clcn1b,clcn1,LOC107744675,LOC107596673,LOC107699941,LOC107569998,LOC107748802,LOC107685513 coding upstream 84142 8731697 ~ 8758899 (-)
casp2 casp2,LOC107748817,LOC107744674 coding upstream 111572 8759127 ~ 8767209 (-)
G110773 NA non-coding downstream 56780 8589898 ~ 8590634 (-)
G110753 NA non-coding downstream 95862 8547782 ~ 8551552 (-)
G110548 NA non-coding downstream 408238 8237758 ~ 8239176 (-)
G110546 NA non-coding downstream 411621 8234908 ~ 8235793 (-)
LOC122360778 NA non-coding downstream 654547 7988950 ~ 7992867 (-)
G110807 NA non-coding upstream 197970 8845525 ~ 8845993 (-)
G110836 NA non-coding upstream 353232 9000787 ~ 9001428 (-)
G110842 NA non-coding upstream 356983 9004538 ~ 9005206 (-)
G110849 NA non-coding upstream 359742 9007297 ~ 9007532 (-)
G110852 NA non-coding upstream 383580 9031135 ~ 9031449 (-)
wu:fj39g12 nppcl,LOC107744681,LOC107699924,LOC107749278,LOC107685603 other downstream 11192 8633350 ~ 8636222 (-)
G110556 NA other downstream 330729 8312265 ~ 8316685 (-)
G110554 cbx3,LOC107596654,LOC107743152,LOC107744695,LOC107550827 other downstream 345169 8298789 ~ 8302245 (-)
G110544 NA other downstream 430819 8216029 ~ 8216595 (-)
mkxb mkxb,LOC107681765,LOC107566716,LOC107691300,LOC107550429,LOC107747522,LOC107708850 other downstream 554959 8082900 ~ 8092455 (-)
G110911 LOC107749154,LOC107686954,LOC107596765,LOC108428931,LOC108268943,LOC107751895,LOC107656720 other upstream 498375 9145930 ~ 9152183 (-)
G110974 NA other upstream 623416 9270971 ~ 9272605 (-)
gask1a fam198a,LOC107732434,LOC107657576,LOC107751903,LOC107704082 other upstream 1229656 9877211 ~ 9902981 (-)
LOC122361037 cables1,LOC107708521,LOC107747516,LOC107681774,LOC107691165 other upstream 2098021 10745576 ~ 10764305 (-)
LOC122360812 cobl,LOC107746964,LOC107684220,LOC107551210 other upstream 2209965 10857520 ~ 10883424 (-)

Expression


Co-expression Network