G126711 (pimr50,si:dkey-1p9.2,pimr51,LOC107716905,LOC107600734)


Basic Information

Item Value
gene id G126711
gene name pimr50,si:dkey-1p9.2,pimr51,LOC107716905,LOC107600734
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056716.1
NCBI id CM032085.1
chromosome length 26409628
location 16208584 ~ 16211583 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU187074
cacacgacatcaagctgctggacttcggctgtggagatctgctgaaagactcggcctacagacactttgcaggcactcttcagtacgcccctcctgagtggtttcggcggcagcgctatcacgcaggaccggctacggtttggtcggtcggggtgacgctctacaacatcttgtgcggctgtttccccttcagaggcacgttgagggtcacctccagaagcagactgcgcttccctagagagctgtccacaggcaagagacagaggtcacgtccagatccaggacacgtagtgttcatgtcttcagaagcttcttggtgagccacatgcccctcgtgatctcgctgatgaagggatttccagacaatggtcacctgtccagaga

Function

symbol description
pimr50 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in negative regulation of apoptotic process; protein autophosphorylation; and regulation of mitotic cell cycle. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in cytoplasm.
pimr51 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in negative regulation of apoptotic process; protein autophosphorylation; and regulation of mitotic cell cycle. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in cytoplasm.

NR:

description
PREDICTED: serine/threonine-protein kinase pim-3-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU187074 True 384 lncRNA 0.57 3 16208584 16211583

Neighbor

gene id symbol gene type direction distance location
LOC122323208 hebp2,LOC107726446,LOC107693223,LOC107732635,LOC107602836,LOC107549119,LOC107696074 coding upstream 89822 16115991 ~ 16118762 (+)
LOC122362747 kifc3,LOC107670565 coding upstream 92740 16090090 ~ 16115844 (+)
LOC122362951 cngb1a coding upstream 123170 16075471 ~ 16085414 (+)
LOC122362746 cngb1a,LOC107670565,LOC107679572 coding upstream 133160 16063967 ~ 16075424 (+)
zgc:158464 LOC107572397,LOC107740353,LOC107692470,LOC107599765,LOC107711356 coding upstream 169673 15955905 ~ 16038911 (+)
hdgfl3 LOC107726337,LOC107595369,LOC107665298,LOC107703942,LOC107754858 coding downstream 118126 16329709 ~ 16334460 (+)
homer2 homer2,LOC107569981,LOC107595365,LOC107703939,LOC108414443 coding downstream 126462 16338045 ~ 16348905 (+)
LOC122362844 fsd2,LOC107726333 coding downstream 150662 16362245 ~ 16368810 (+)
zgc:158482 LOC107727401,LOC107703947,LOC107569985 coding downstream 199782 16411365 ~ 16419019 (+)
slc27a2a NA coding downstream 208611 16420194 ~ 16426174 (+)
LOC122362955 NA non-coding upstream 149610 16058534 ~ 16058974 (+)
G126626 NA non-coding upstream 204766 15999452 ~ 16003818 (+)
G126605 NA non-coding upstream 380231 15825427 ~ 15828353 (+)
G126591 NA non-coding upstream 388254 15760963 ~ 15820330 (+)
G126458 NA non-coding upstream 1142007 15066346 ~ 15066577 (+)
G126716 homer2,LOC107569981,LOC107703939,LOC107595365 non-coding downstream 55431 16267014 ~ 16364205 (+)
G126722 whamm,LOC107595364 non-coding downstream 143648 16355231 ~ 16361646 (+)
LOC122362848 NA non-coding downstream 164855 16376438 ~ 16378666 (+)
G126743 gatm,LOC107726335,LOC107665388 non-coding downstream 193872 16405455 ~ 16406624 (+)
G126723 NA non-coding downstream 242414 16453997 ~ 16494634 (+)
LOC122362745 si:ch211-71n6.4,si:dkey-30c15.17,LOC107686550,LOC107559644,LOC107753016,LOC107758068,LOC107670624,LOC107672404,LOC107733274 other upstream 152957 16047069 ~ 16055627 (+)
LOC122362954 LOC107740354 other upstream 254931 15950982 ~ 15953653 (+)
LOC122362588 NA other upstream 1160691 15035383 ~ 15047893 (+)
LOC122322993 LOC107709552 other upstream 1298427 14906616 ~ 14910157 (+)
gemin7 NA other upstream 1380292 14826788 ~ 14828292 (+)
LOC122362750 homer2,homer3,LOC107595365,LOC107569981,LOC107703939,LOC107726331,LOC107723860,LOC107692231,LOC107572947,LOC107753825 other downstream 52256 16263839 ~ 16271267 (+)
G126820 NA other downstream 542126 16753709 ~ 16818399 (+)
G126884 ctxn2 other downstream 862611 17074194 ~ 17077159 (+)
LOC122362575 NA other downstream 918339 17129922 ~ 17171335 (+)
LOC122322904 NA other downstream 1092186 17303769 ~ 17309158 (+)

Expression


Co-expression Network