CI01000001_02141590_02142836 (COPZ1, COPZ1.L, COPZ1-B)


Basic Information

Item Value
gene id CI01000001_02141590_02142836
gene name COPZ1, COPZ1.L, COPZ1-B
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 2141560 ~ 2142986 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000001_02141590_02142836.mRNA
ATTTCCCACAATATTTTTCCGCAATTATCAATGACGTTACAAAGTACTTCCGCTTAGTTTTGCCCTTTTACCTCATGTCGTAAGCGGAAGTACACATACGCAGGAATTCAATACACGGAGCTGGAGTGAGTAACTTCTGCACAGTACAAGATGGATACGCTAATACTGGAGCCCTCTCTCTACACTGTAAAAGCTGTTCTGATCATGGACAATGACGGAGAGAGACTTTATGCTAAGTATTATGATGACACATACCCCACAGTGAAAGAGCAGAAAGCCTTTGAGAAGAACATCTTCAACAAGACACACAGGACAGACAGTGAAATAGCATTGCTGGAGGGTCTAACGGTTGTGTACAAGAGCAATATTGATTTGTATTTCTACGTAATCGGCAGCTCCCATGAAAATGAGCTGATGCTTATGTCAGTGTTGAATTGTCTCTTTGATTCCTTGAGCCAAATGTTGAGGAAAAATGTAGAAAAGAGAGCCCTGCTTGAAAATATGGAGGGTCTTTTCCTGGCCGTTGATGAGATTGTTGATGGAGGGTAAGGCATAATTAATGTATTCAAACTTATTAAA

Function

symbol description
copz1 Acts upstream of or within lens development in camera-type eye. Predicted to be located in Golgi membrane and cytoplasmic vesicle. Predicted to be part of COPI vesicle coat. Orthologous to human COPZ1 (COPI coat complex subunit zeta 1).

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG:

id description
K20472 COPZ, RET3; coatomer subunit zeta

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000001_02141590_02142836.mRNA True 579 mRNA 0.41 6 2141560 2142986

Neighbor

gene id symbol gene type direction distance location
CI01000001_02126257_02127537 NA coding downstream 13993 2125065 ~ 2127567 (-)
CI01000001_02057429_02071506 LIMA1A coding downstream 70054 2056814 ~ 2071506 (-)
CI01000001_01999489_02002753 IGFBP6B, IGFBP6 coding downstream 138632 1998128 ~ 2002928 (-)
CI01000001_01976950_01992032 GPR182, PIP4K2CA, PIP4K2C coding downstream 147999 1976716 ~ 1993561 (-)
CI01000001_01932927_01933914 TSPAN31 coding downstream 207646 1932621 ~ 1933914 (-)
CI01000001_02159372_02162554 HNRNPA1, ROA1 coding upstream 16173 2159159 ~ 2162554 (-)
CI01000001_02173311_02179118 NA coding upstream 29784 2172770 ~ 2180987 (-)
CI01000001_02236985_02242725 HOXC1A coding upstream 93596 2236582 ~ 2243993 (-)
CI01000001_02258523_02262621 NA coding upstream 115456 2258442 ~ 2263103 (-)
CI01000001_02274875_02276207 HOXC4, HOXC4A coding upstream 131306 2274292 ~ 2276769 (-)
G14293 NA non-coding downstream 22994 2118355 ~ 2118566 (-)
G14198 NA non-coding downstream 38091 2102589 ~ 2103469 (-)
G14216 NA non-coding downstream 39059 2102156 ~ 2102501 (-)
G14213 NA non-coding downstream 134511 2005295 ~ 2007049 (-)
G14217 NA non-coding downstream 136497 2004161 ~ 2005063 (-)
G14297 NA non-coding upstream 155 2143141 ~ 2143365 (-)
G14300 NA non-coding upstream 5728 2148714 ~ 2148937 (-)
G14301 NA non-coding upstream 8140 2151126 ~ 2151456 (-)
G14304 NA non-coding upstream 11396 2154382 ~ 2154883 (-)
G14335 NA non-coding upstream 224872 2367858 ~ 2368107 (-)
G14228 NA other downstream 85082 2055974 ~ 2056478 (-)
G14219 NA other downstream 146662 1994210 ~ 1994898 (-)
G14104 NA other downstream 374102 1763669 ~ 1771468 (-)
CI01000001_00362143_00378213 NA other downstream 1744427 361614 ~ 378213 (-)
CI01000001_00238241_00249437 NA other downstream 1884043 238241 ~ 249437 (-)
CI01000001_04395469_04399381 FKBP1B.L, FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A other upstream 2249328 4392314 ~ 4399804 (-)
CI01000001_04468566_04523431 DNMT3BB.1 other upstream 2333298 4468209 ~ 4523431 (-)
CI01000001_04726550_04727511 PDPFB, PPDPFB, PPDPF other upstream 2426096 4725927 ~ 4728210 (-)
G15736 NA other upstream 2657915 4800901 ~ 4801395 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_021873 copz1 coding NC_007134.7 CM002907.2 36340520 ~ 36354106 (+)
bowfin (Amia calva) AMCG00008820 copz1,LOC105907582,LOC107664248 coding CM030126.1 CM030126.1 12688197 ~ 12693501 (+)