G129920


Basic Information

Item Value
gene id G129920
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056717.1
NCBI id CM032086.1
chromosome length 20532727
location 2311285 ~ 2312455 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU191830
TGCTCATACGGCGAGAAGGTTCCCGCATCGATGTTGATGTACGGGTCGATCTTGATGGCTGTGACATGCAGGCCGCAGGACTTGAGGATGGTTCCCACACTGCTGGCTATAATGCCTTTCCCGATGCCTGAGATCACACCGCCCGTCACCAGAATATACTTCATGCTGCCAATCACACCCTGGATGTAAAATACCGGACCGTCCTGGTGCGACAGACCTACCACGATATCTCGAAAGCGCGAAACCCGTTGTTAAAGCGATAACAAACGTGTTCACATCACACGTGCTGCTCGACCTCAGAGTAGCGGAACACATACGGCGAGCC

Function

GO:

id name namespace
GO:0001775 cell activation biological_process
GO:0030168 platelet activation biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU191830 True 325 lncRNA 0.54 2 2311285 2312455

Neighbor

gene id symbol gene type direction distance location
cited4a LOC107689549,LOC107556893,LOC107595899,LOC107732920,LOC107675931 coding downstream 52851 2253838 ~ 2258434 (-)
LOC122324005 NA coding downstream 249560 2060114 ~ 2061725 (-)
ube2e1 ube2e1,LOC107655879,LOC107565235,LOC107743927,LOC105903698,LOC107700659 coding downstream 306251 1991179 ~ 2005034 (-)
rpl15 rpl15 coding downstream 324096 1983801 ~ 1987189 (-)
nr1d2b nr1d2b,LOC107565234,LOC107700655,LOC107719847,LOC107569910,LOC107743928 coding downstream 332945 1970767 ~ 1978340 (-)
stmn1a LOC103471979,LOC105933928,LOC102781761,LOC107098265,LOC104924882,LOC103142368,LOC100709328 coding upstream 421281 2733736 ~ 2736130 (-)
maneal si:ch211-30b16.2,LOC107569868,LOC107686956,LOC107708724,LOC107719841,LOC107693995 coding upstream 564469 2876924 ~ 2884651 (-)
oprd1a oprd1a,LOC107688080,LOC107595906,LOC107732912,LOC107689567,LOC108411271 coding upstream 691537 3003992 ~ 3022358 (-)
arid1ab LOC107712599,LOC107700714,LOC107550655,LOC107737764 coding upstream 1071282 3383737 ~ 3437997 (-)
nudc nudc,LOC107689540,LOC107700719,LOC107567584,LOC107550646,LOC107729000 coding upstream 1184244 3496699 ~ 3501432 (-)
G129902 NA non-coding downstream 170311 2139878 ~ 2140974 (-)
LOC122323752 NA non-coding downstream 182173 2122686 ~ 2129112 (-)
G129889 NA non-coding downstream 208181 2102703 ~ 2103104 (-)
G129887 NA non-coding downstream 228543 2082234 ~ 2082742 (-)
G129876 NA non-coding downstream 284083 2026237 ~ 2027202 (-)
LOC122324052 NA non-coding upstream 5699 2318154 ~ 2320104 (-)
LOC122324257 NA non-coding upstream 6072 2318527 ~ 2318597 (-)
LOC122324258 NA non-coding upstream 6517 2318972 ~ 2319048 (-)
LOC122324259 NA non-coding upstream 6781 2319236 ~ 2319373 (-)
G129938 NA non-coding upstream 31797 2344252 ~ 2344505 (-)
G129738 NA other downstream 811879 1498688 ~ 1499406 (-)
pef1 pef1,LOC107664714,LOC107726139,LOC107698987,LOC107712637 other downstream 1024079 1281539 ~ 1287206 (-)
smim12 smim12,LOC107664707,LOC107726140,LOC107563281,LOC107712635,LOC107555952,LOC107698988 other downstream 1030776 1278912 ~ 1280509 (-)
LOC122323272 NA other downstream 1216382 1072151 ~ 1094903 (-)
thsd7aa NA other downstream 1259161 1017155 ~ 1052124 (-)
LOC122323398 pkib,LOC107098269 other upstream 427549 2740004 ~ 2751570 (-)
G130000 NA other upstream 512889 2825344 ~ 2832956 (-)
G130041 LOC107687396,LOC107708727,LOC107595896 other upstream 596034 2908489 ~ 2911603 (-)
G130083 LOC103461248,LOC102786159 other upstream 836699 3149154 ~ 3149789 (-)
LOC122323345 fam46bb,LOC107712594,LOC107700817,LOC107737782,LOC108413340,LOC103370123 other upstream 1000934 3313389 ~ 3323828 (-)

Expression


Co-expression Network