G130476 (pabpc1b,LOC107698655,LOC107748365,LOC107550093,LOC107738317)


Basic Information

Item Value
gene id G130476
gene name pabpc1b,LOC107698655,LOC107748365,LOC107550093,LOC107738317
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056717.1
NCBI id CM032086.1
chromosome length 20532727
location 4490260 ~ 4491487 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU192630
CCCCAGCCCTATTGAATATCCTGTCACCAAAACCTCATGGTGCTGTGGTGCATGTAAAGGCTGAAACTACTCACCCACACGCTGAGTGGACATCATGCGGGGCACCTGAGACGCAGGACGCATGGCGCTGAAGGTCTGAGGTCTTGGGGCAGAGGGGCGCATTGTGCCTGGCATGTTCTGGAAGTCTGTAAAAAGGGTTCGATGTCTTCATCAGTATGAATCGGTACTATCACTGATGAAAAAGTTGACTTACGCTGAGGACGGACACCCTGTGAGGTCCAGCGGGGACTGGGTCTGAGCTGCGTGAGCTGACTGGTAGGGTAATACGCAGCTCTGTTCTGGCCTGTGGAATGGCAGCCATGAAGTATCCTGATGGAGGTGCAGGCTGGTAGGGGTTGATGACGGGGTTTGGCACGGCGCGGACACTAGCCATCCTCTGCATGTACTGGTTGGTGAGATGGGCCTGCCGTTCCTCCTTGCGCTGAGCAAGAGCCACATACAATGGCTTGGTGGCCACGATACGGCCATTCATCTCAGTCACCGCTTTAGTGGCTTCCTCAGGCGAAGAGAAACAGACAAATCCAAAGCCTTTACTGCGACCCCCGTCCATCATGACCTGTGACAAAAGACGGAGAACACTTCAATTTTTGTCTAAAAGGCAACATGCAAC

Function

symbol description
pabpc1b Predicted to enable RNA binding activity. Predicted to be located in cytoplasm. Is expressed in several structures, including alar plate midbrain region; nervous system; notochord; pronephric duct; and yolk syncytial layer. Orthologous to human PABPC1 (poly(A) binding protein cytoplasmic 1).

NR:

description
PREDICTED: polyadenylate-binding protein 1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU192630 True 670 lncRNA 0.54 2 4490260 4491487

Neighbor

gene id symbol gene type direction distance location
grhl2b grhl2b,grhl2,LOC107738316,LOC107672862,LOC107748368,LOC107698657,LOC107552317,LOC107550099 coding downstream 39799 4432143 ~ 4450461 (-)
psmg2 psmg2,LOC107738327,LOC107748372,LOC107672829,LOC107550101 coding downstream 79326 4408733 ~ 4410934 (-)
seh1l seh1l,LOC107668717,LOC107746927,LOC107748371,LOC107666589 coding downstream 102645 4378514 ~ 4387615 (-)
ldlrad4a ldlrad4a,LOC107668709,LOC107675658,LOC107566561,LOC107746928 coding downstream 113900 4303415 ~ 4376360 (-)
rnmt rnmt,LOC107668718,LOC107754922,LOC107566559 coding downstream 193503 4285292 ~ 4296757 (-)
spag1a spag1a,LOC107738319,LOC107672845,LOC107748364,LOC107698654,LOC107550092 coding upstream 38037 4529524 ~ 4537983 (-)
adck5 adck5 coding upstream 81961 4573448 ~ 4580921 (-)
LOC122323748 pqlc1,LOC107698648,LOC107672885 coding upstream 215835 4707322 ~ 4735660 (-)
LOC122323359 si:dkey-222b8.4,LOC107672841,LOC107698638,LOC107563916,LOC107745050 coding upstream 317627 4809114 ~ 4820027 (-)
LOC122323699 chtopa,chtop,LOC107672843,LOC107563917,LOC107698644 coding upstream 330250 4821737 ~ 4827915 (-)
G130482 NA non-coding downstream 5864 4469759 ~ 4484396 (-)
G130494 NA non-coding downstream 81866 4408194 ~ 4408394 (-)
LOC122323668 NA non-coding downstream 84360 4404017 ~ 4405900 (-)
G130465 NA non-coding downstream 189934 4298509 ~ 4300326 (-)
G130463 NA non-coding downstream 202390 4287488 ~ 4287870 (-)
G130690 NA non-coding upstream 247318 4738805 ~ 4744555 (-)
G130702 NA non-coding upstream 281333 4772820 ~ 4903960 (-)
G130708 NA non-coding upstream 300363 4791850 ~ 4922621 (-)
G130713 NA non-coding upstream 338537 4830024 ~ 4964829 (-)
G130716 NA non-coding upstream 357662 4849149 ~ 4986966 (-)
tmem222b tmem222b,LOC105903612,LOC107550652,LOC107754919,LOC107567586,LOC107700749 other downstream 938435 3537441 ~ 3551825 (-)
kdf1b LOC107700730,LOC107712602,LOC107550653,LOC107754920,LOC107567594,LOC107689538 other downstream 975581 3508834 ~ 3514679 (-)
zdhhc18b zdhhc18b,LOC107700701,LOC107737765,LOC107689541,LOC108413341,LOC107550656,LOC107570996 other downstream 1110333 3363481 ~ 3379927 (-)
LOC122323345 fam46bb,LOC107712594,LOC107700817,LOC107737782,LOC108413340,LOC103370123 other downstream 1166432 3313389 ~ 3323828 (-)
G130083 LOC103461248,LOC102786159 other downstream 1340471 3149154 ~ 3149789 (-)
polr2k NA other upstream 48492 4539979 ~ 4541629 (-)
G130696 NA other upstream 252085 4743572 ~ 4941832 (-)
LOC122323502 s100v2,LOC107672873,LOC107598219,LOC107748347,LOC107676101,LOC107550199 other upstream 595757 5087244 ~ 5222883 (-)
G130744 sema4ab,LOC107702572,LOC107672813,LOC107598230,LOC107731578,LOC107705066 other upstream 650018 5141505 ~ 5260164 (-)
G130763 NA other upstream 753866 5245353 ~ 5252189 (-)

Expression


Co-expression Network