G130969 (jarid2,LOC107568290,LOC107702394,LOC107754814,LOC107694367,LOC107731546)


Basic Information

Item Value
gene id G130969
gene name jarid2,LOC107568290,LOC107702394,LOC107754814,LOC107694367,LOC107731546
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056717.1
NCBI id CM032086.1
chromosome length 20532727
location 6153039 ~ 6155564 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU193367
GTCAAAGATACCGATCTCCTTGTATATACATTTGTGCTGGTCACTGAGAACACCTTCATCTTCTGTCTCCACATCTGCCTCATCATTGTCCACTTTTTCCCCTTTCTTTTCCTGAGCAAACAGTCTGCGGCGGCCGGCCTGCCGCTGGGTGTCTGGCTCTTTGTTGTGATTGCGGAAGCCATTGCGGTGGTGGAGGCCGGTGAGCCCATTCTTGGGTTCGTAACGGGGAAGAGCCAGAGACCGCTGGCCATTATCCGAGTGGCCCTCCAGGGGTCCCCGCTTGCGTTCCAGAGCTTCCTTCTCTGCCAGCACCTCCTGCTCCAGTCGCCGGTGCTCCTCTGGGGAGAGCAGGTCATAGGAGAGCAGGTATTGAAGGTAGGCCTCCTGGAGCTTGGCCAGACGGTCCTGTGCTGATTTGGGAATGCGAAGCAGGTCAGCCAACCGGCTCCATTTTTTCAGGTCCATCACCTGCTGCATTCCACCCATGTCGCAGACCAGCTCGGAAAAACGAGCCAGATCTACTTCAC

Function

symbol description
jarid2 Predicted to enable chromatin binding activity and histone demethylase activity. Predicted to be involved in several processes, including chromatin remodeling; negative regulation of transcription, DNA-templated; and regulation of histone methylation. Predicted to act upstream of or within several processes, including cellular response to leukemia inhibitory factor; hematopoietic or lymphoid organ development; and liver development. Located in mitochondrion and nucleoplasm. Implicated in autistic disorder. Biomarker of aortic valve stenosis.

NR:

description
PREDICTED: protein Jumonji

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU193367 True 527 lncRNA 0.56 2 6153039 6155564

Neighbor

gene id symbol gene type direction distance location
pard6gb pard6gb,LOC107672872,LOC107754812,LOC107702404,LOC107731577 coding downstream 182468 5939450 ~ 5970571 (-)
bloc1s4 bloc1s4,LOC107672822,LOC107568287,LOC107702415,LOC107731556,LOC107598233 coding downstream 214455 5933632 ~ 5938584 (-)
asns asns,LOC107754811,LOC107731557,LOC107702657,LOC107672863 coding downstream 220212 5923625 ~ 5932827 (-)
LOC122323838 npr1a,LOC107694365,LOC107754786,LOC107731544,LOC107677481,LOC107595610,LOC107584346 coding downstream 316661 5811984 ~ 5836378 (-)
LOC122323412 c1galt1,si:dkey-202e17.1,LOC107702589,LOC107568284,LOC107754798,LOC107731548 coding downstream 408462 5739319 ~ 5744577 (-)
dtnbp1b dtnbp1b,LOC107568291,LOC107754801,LOC107731565,LOC107694327,LOC107598220 coding upstream 8259 6163823 ~ 6192690 (-)
csnk2b csnk2b,LOC102207154,LOC106594067,LOC101175345,LOC100710962,LOC106573472 coding upstream 235253 6390817 ~ 6395006 (-)
prrc2a LOC107754821,LOC107694359,LOC107584310,LOC107711320,LOC107595587,LOC107677454 coding upstream 240195 6395759 ~ 6415177 (-)
LOC122323484 neu1,LOC107677467,LOC107711305,LOC107694326,LOC107595619,LOC107754787 coding upstream 269903 6425467 ~ 6429491 (-)
LOC122323486 neu1,LOC107694358,LOC107754788,LOC107711321,LOC107677466 coding upstream 274071 6429635 ~ 6433398 (-)
G130920 NA non-coding downstream 269672 5752585 ~ 5883367 (-)
G130914 NA non-coding downstream 276326 5745848 ~ 5876713 (-)
LOC122324223 NA non-coding downstream 305280 5838793 ~ 5847759 (-)
G130880 NA non-coding downstream 478161 5674554 ~ 5674878 (-)
G130827 NA non-coding downstream 630073 5520939 ~ 5522966 (-)
G130973 NA non-coding upstream 42561 6198125 ~ 6198361 (-)
G130978 NA non-coding upstream 78480 6234044 ~ 6236277 (-)
G130982 NA non-coding upstream 92787 6248351 ~ 6293266 (-)
G130999 NA non-coding upstream 199392 6354956 ~ 6355475 (-)
G131114 NA non-coding upstream 282641 6438205 ~ 6440082 (-)
LOC122324254 NA other downstream 747403 5404516 ~ 5405636 (-)
G130744 sema4ab,LOC107702572,LOC107672813,LOC107598230,LOC107731578,LOC107705066 other downstream 892875 5141505 ~ 5260164 (-)
G130763 NA other downstream 900850 5245353 ~ 5252189 (-)
LOC122323502 s100v2,LOC107672873,LOC107598219,LOC107748347,LOC107676101,LOC107550199 other downstream 930156 5087244 ~ 5222883 (-)
G130696 NA other downstream 1211207 4743572 ~ 4941832 (-)
G131006 LOC107754818,LOC107731580 other upstream 206783 6362347 ~ 6363172 (-)
sh3bp5lb sh3bp5lb,LOC107711328,LOC107677461,LOC107694325,LOC107754828,LOC107584304,LOC108435520 other upstream 472034 6627598 ~ 6639220 (-)
polr1h znrd1,LOC107584303,LOC107754832,LOC107677479,LOC107694346,LOC107595594 other upstream 492826 6648390 ~ 6649389 (-)
srd5a1 srd5a1,LOC107691541,LOC107711310,LOC107595623,LOC107694335 other upstream 694805 6850369 ~ 6858660 (-)
LOC122323893 ppp1r11,LOC107595604,LOC107694341,LOC107711309,LOC107677477 other upstream 1201057 7356621 ~ 7360143 (-)

Expression


Co-expression Network