G132913 (trps1,LOC107706219,LOC107592043,LOC107754280,LOC107696539,LOC107562946)


Basic Information

Item Value
gene id G132913
gene name trps1,LOC107706219,LOC107592043,LOC107754280,LOC107696539,LOC107562946
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056717.1
NCBI id CM032086.1
chromosome length 20532727
location 14168095 ~ 14168484 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU196327
CTGTGTGTGGCGTCCCTCTCCTCTCCGTTACTGGTGCAGCCCTGTACGATGACGCCACCTGACCGGGTGCTGGGTTTTAGACCATTCCGCTCATCCTCACAGTCTCCTCTTTCACCTGGATCAGAGTTTGTCGGGGAGGCGGTAGAGTCCAGCGGTTCGGTATCTGTGCCCTCGCGGCTGGAGTAGGATGCTGCCAGGTTGTGGCTGGAGTAATGCAAGTCAGGTCTATCTGGTTTGATGGGGCCAGGGGAGGACGGTTCCTCCTGTTCTTCGCCCACAGCCCGGTCGGGCTCTGAGGCCTGGCTCCCCGCGTTCCCGCTCTCTGGGCTCGTGGCCTCGGCCGCCACCGCTTCGCCCTCCTCTTCTTCACCGCCGAAGCTTCTCAAAGGG

Function

symbol description
trps1 Predicted to enable RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be located in nucleus. Human ortholog(s) of this gene implicated in osteochondrodysplasia; trichorhinophalangeal syndrome type I; and trichorhinophalangeal syndrome type III. Orthologous to human TRPS1 (transcriptional repressor GATA binding 1).

NR:

description
PREDICTED: zinc finger transcription factor Trps1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU196327 True 390 lncRNA 0.62 1 14168095 14168484

Neighbor

gene id symbol gene type direction distance location
lrrc14b lrrc14b,LOC107706156,LOC107654673,LOC107742820,LOC107696555 coding upstream 526026 13638212 ~ 13642069 (+)
LOC122323661 LOC107654672,LOC107706155,LOC107592076,LOC107742821,LOC107696516,LOC107696575 coding upstream 530007 13627237 ~ 13638088 (+)
ankib1a LOC107706216,LOC107654707,LOC107742824,LOC107696581,LOC107589494 coding upstream 613261 13536137 ~ 13554834 (+)
lypla2 lypla2,LOC107654706,LOC107706215,LOC107696570,LOC107742825 coding upstream 633117 13528592 ~ 13534978 (+)
pithd1 pithd1,LOC107654704,LOC107696572 coding upstream 640177 13525347 ~ 13527918 (+)
utp23 utp23 coding downstream 174125 14342609 ~ 14343877 (+)
stmnd1 LOC107592082,LOC107706159,LOC107654715 coding downstream 219271 14387755 ~ 14391343 (+)
rbm24a rbm24a,LOC107696536,LOC107592929,LOC107706227,LOC107654717,LOC107754275,LOC107591968 coding downstream 226152 14394636 ~ 14405903 (+)
cap2 cap2,LOC107706226,LOC107754274,LOC107592045 coding downstream 240505 14408989 ~ 14428817 (+)
vps28 vps28,LOC107696523,LOC107592928,LOC107754273 coding downstream 263218 14431702 ~ 14434903 (+)
G132910 NA non-coding upstream 61834 14097276 ~ 14106261 (+)
G132884 NA non-coding upstream 319980 13846782 ~ 13848115 (+)
G132774 NA non-coding upstream 606650 13561167 ~ 13561445 (+)
G132773 NA non-coding upstream 611416 13555011 ~ 13556679 (+)
G132754 klhl43,LOC107589442,LOC107706211,LOC107742826,LOC107591641,LOC107696549,LOC108426671 non-coding upstream 654199 13513022 ~ 13513896 (+)
G132916 NA non-coding downstream 7355 14175839 ~ 14582416 (+)
G133068 NA non-coding downstream 589140 14757624 ~ 14757976 (+)
LOC122324050 NA non-coding downstream 853791 15022275 ~ 15035422 (+)
G133109 ppce,LOC107602379,LOC107688393,LOC107706142,LOC107592053,LOC107654745,LOC107710331 non-coding downstream 1027573 15196057 ~ 15281004 (+)
G133129 NA non-coding downstream 1206016 15374500 ~ 15378019 (+)
sdc3 LOC107697058,LOC107696563,LOC107593566,LOC107742841,LOC107706193,LOC107591629 other upstream 831346 13309427 ~ 13336749 (+)
jtb jtb,LOC107706175,LOC107591609,LOC107731414,LOC107593543 other upstream 1142069 13021417 ~ 13026026 (+)
gngt1 gngt1,LOC103023645,LOC108257427,LOC107085869 other upstream 1743017 12423290 ~ 12425078 (+)
LOC122323774 NA other upstream 2055198 12111279 ~ 12112897 (+)
LOC122323782 smim12,LOC107664707,LOC107726140,LOC107563281,LOC107712635,LOC107555952,LOC107698988 other upstream 2644214 11522229 ~ 11523881 (+)
G133066 ext1c,LOC107654729,LOC107706241,LOC107592050,LOC107754264,LOC107592945,LOC107688378 other downstream 619060 14787544 ~ 15212430 (+)
LOC122323257 tpmt,tpmt.1,LOC107591974,LOC107688424 other downstream 666117 14834601 ~ 14837969 (+)
LOC122323518 LOC107654743,LOC107688368,LOC107602377,LOC108413484,LOC107706254,LOC107710329 other downstream 909970 15078454 ~ 15192566 (+)
LOC122323314 LOC107602378,LOC107591987,LOC107706255,LOC107710332,LOC107688367,LOC107654747 other downstream 1140243 15308727 ~ 15313877 (+)
anxa14 LOC107706258,LOC107654687,LOC107710308,LOC107592054,LOC107688418 other downstream 1187124 15355608 ~ 15361845 (+)

Expression


Co-expression Network