apoea (apoe,LOC107565590,LOC107748767,LOC107656622,LOC107739531,LOC107599552)


Basic Information

Item Value
gene id apoea
gene name apoe,LOC107565590,LOC107748767,LOC107656622,LOC107739531,LOC107599552
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056717.1
NCBI id CM032086.1
chromosome length 20532727
location 17083910 ~ 17085916 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043217746.1
ATTATGGCTATCAACATGACTGTGATCCAAATCATATAAATACCAGCTGCTTCCAAACTCCCGTTACAGAACACATTGGAAAATCTGTCTGGTGTACTGTCCAAAAACAATCATGAAGTTTGCGGCTGTAATCCTTGCTCTCGCTGTCATTTCAGGCTGTCAGGGGCGCTTCCTGTTTCAGGATGAGCCAAAAAGCCGCTGGGAAGAGGCAGTGGATCAGTTCTGGAACCATGTGTCCGAGCTGACCACTAAGGCTCAAGAGATGAAGGACAACATCAAGGCCACCAAGCTGGGCAGAGAGTTAGACACACTGATCATTGACACCATGATGGAGGTGGACATGTACAAACATAACTTGCGCTCCAAGCTGGGCCCTTATGCGCATGAGACTGCCCAGAAATTCAATGAAGATGTTCAGCTGCTGGTCAATAAGCTCCGCGCACATATGGAGGAAGCTAAGGATCGTGTCAGTGAATACACCGAGGAGTTCCGGATCATTGTGGAACAGAACAGTGATGAGGTCAAGAACAAGGTCAACAACTACGCCAAGAAACTAAGGAAGCGTTTTAACAAGGACATCCAAGAGATCAACAAGAAAATGTCAACATACATTGAGGAGGTTCGCTCTCGTGCTACTCAGGGTATGGAGGACGTGAAGGATCGTCTCGAGCCTTACTTCACCTCAGTGCGTCAGCGTGCTGAAGAGAAGCTCACAACTCTGGCAGATCTGCTGAGAAGCCAGGGAGAAGATCTGAAAGAGAAACTGGAATCACGGATGCAGGACCTTAAAGAGAAAGCTGAGAAGAGCACAGAGAATATGCGTAACACAATTCAGGAAAAGACAGAGGAGATAAAAAGTTGGTTAGAGCCCTATGTGTCTCAGGTCCAGAAGCAACTAGAGACAGTCATGGAGGGCTTGTAATAACAGCATATACAAATGAGGTCTCATAGGAAAATTAATAGATTAACTTTTATACTAAACGTTGCTTCCAGAAATGAAAGTACTGGAAACGTCAAAGTTATGAGTGAAATATACCATTTGTACTACATGGATGTAACAACAGATGTAAGCTATGCAATATAAAGTTCAATAAAACCAGCATGTACCAATGAG

Function

symbol description
apoe Enables several functions, including amyloid-beta binding activity; heparan sulfate proteoglycan binding activity; and lipoprotein particle receptor binding activity. Involved in several processes, including lipid transport; regulation of lipid transport; and regulation of protein metabolic process. Acts upstream of or within with a positive effect on AMPA glutamate receptor clustering and NMDA glutamate receptor clustering. Acts upstream of or within negative regulation of dendritic spine development; positive regulation of dendritic spine development; and regulation of dendritic spine maintenance. Located in several cellular components, including Golgi apparatus; endoplasmic reticulum; and extracellular space. Part of several cellular components, including chylomicron; low-density lipoprotein particle; and triglyceride-rich plasma lipoprotein particle. Is active in glutamatergic synapse and synaptic cleft. Implicated in several diseases, including Alzheimer's disease (multiple); artery disease (multiple); biliary tract cancer (multiple); eye disease (multiple); and familial hyperlipidemia (multiple). Biomarker of several diseases, including Lewy body dementia; diabetes mellitus (multiple); end stage renal disease; neurodegenerative disease (multiple); and obesity.

NR:

description
PREDICTED: apolipoprotein E

GO:

id name namespace
GO:0042157 lipoprotein metabolic process biological_process
GO:0006869 lipid transport biological_process
GO:0005576 extracellular region cellular_component
GO:0008289 lipid binding molecular_function

KEGG:

id description
K04524 APOE; apolipoprotein E

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043217746.1 True 1114 mRNA 0.44 4 17083910 17085916

Neighbor

gene id symbol gene type direction distance location
si:ch73-347e22.4 LOC107693273,LOC107748715,LOC107565585,LOC107739595 coding downstream 367 17072331 ~ 17083543 (-)
si:ch73-347e22.8 NA coding downstream 32291 17048539 ~ 17051619 (-)
msmp2 si:ch1073-70f20.1,LOC107748766,LOC107565577,LOC107693399,LOC107656628,LOC107599557 coding downstream 40921 17041975 ~ 17042989 (-)
si:ch73-109i22.2 LOC107748764,LOC107667791,LOC107739537,LOC107656629,LOC107599558,LOC107579479,LOC107565563 coding downstream 117795 16959151 ~ 16966115 (-)
grb10a grb10a,LOC107667783,LOC107739542,LOC107565574,LOC108440880,LOC107656633,LOC108273075,LOC105905327 coding downstream 139387 16901770 ~ 16944523 (-)
apoa4a apoa4a,LOC107693394,LOC107599550,LOC107748768,LOC107739627 coding upstream 1507 17087423 ~ 17088750 (-)
tomm40l tomm40,tomm40l,LOC107748716,LOC107739529,LOC107656621,LOC107599548 coding upstream 4703 17090619 ~ 17094505 (-)
LOC122324173 LOC107693391,LOC107565587,LOC107599547,LOC107656619,LOC107739594,LOC108444404,LOC103037120,LOC105028270,LOC106588242 coding upstream 9618 17095534 ~ 17104511 (-)
lipea LOC107599546,LOC107739528,LOC107748718,LOC107693390,LOC107565586,LOC107656618 coding upstream 19024 17104940 ~ 17125195 (-)
ago3b ago3b,LOC107599544,LOC107656616,LOC107693387,LOC108272767 coding upstream 55911 17141827 ~ 17159268 (-)
G133887 NA non-coding downstream 27043 17056425 ~ 17056867 (-)
G133886 NA non-coding downstream 27599 17056101 ~ 17056311 (-)
G133865 NA non-coding downstream 42117 16974031 ~ 17041793 (-)
G133861 slc9a3.2,LOC107656591,LOC107739626,LOC107693290,LOC107748744,LOC107599577,LOC107565571 non-coding upstream 41750 17127666 ~ 17131995 (-)
G133902 NA non-coding upstream 77916 17163832 ~ 17164115 (-)
LOC122323277 NA non-coding upstream 78778 17164694 ~ 17168108 (-)
G133919 sbk2,LOC107724114,LOC107693243,LOC107739621,LOC107656585,LOC107599589 non-coding upstream 162768 17248684 ~ 17251304 (-)
G133920 NA non-coding upstream 174794 17260710 ~ 17261499 (-)
trnap-ugg_15 NA other downstream 183134 16900705 ~ 16900776 (-)
LOC122324115 NA other downstream 185309 16897995 ~ 16898601 (-)
LOC122324113 NA other downstream 186767 16896108 ~ 16897143 (-)
LOC122324112 NA other downstream 191329 16891692 ~ 16892581 (-)
LOC122324114 NA other downstream 193036 16889829 ~ 16890874 (-)
LOC122323474 LOC107589464,LOC107589461,LOC107656564,LOC107739585,LOC107599573,LOC107656565,LOC107739586,LOC107599590,LOC107693268,LOC107739622,LOC107589465,LOC107724065,LOC107656563 other upstream 128045 17213961 ~ 17218790 (-)
G133949 NA other upstream 197416 17283332 ~ 17284744 (-)
G133948 LOC107693373,LOC107724108,LOC107739520,LOC107599537 other upstream 244781 17330697 ~ 17334234 (-)
LOC122324164 LOC107589398,LOC107693356,LOC107724088,LOC107589397,LOC107599520,LOC107665487,LOC107724089 other upstream 527530 17613446 ~ 17616277 (-)
s100a10a s100a10a,LOC107599503,LOC107693282,LOC107589481,LOC107589504,LOC103356278 other upstream 843773 17929689 ~ 17935436 (-)

Expression


Co-expression Network