LOC122323831 (sema4ab,LOC107702572,LOC107731578,LOC107705066,LOC107598230,LOC107672813)


Basic Information

Item Value
gene id LOC122323831
gene name sema4ab,LOC107702572,LOC107731578,LOC107705066,LOC107598230,LOC107672813
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056717.1
NCBI id CM032086.1
chromosome length 20532727
location 5138430 ~ 5143254 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043217933.1
ATGCCGTTCTCGCAATCGGCGTCCGGTCAGAGTGATGCGATGACCTTGAAGGAGAAGTTGGACTGGTCTCCGTCAGAAAAAGATCTTACTGACTGTGCTATGAAAGGCAAAATGAAGATGGACTGTCATAACTTCGTGAGGGTTTTACAAGTGCTGAACTCCACTCATATGTTCTCCTGTGGAACCTTTGCCTTCAGCCCGCGCTGCATCTACATCAATTCAGAGACATTTTCCATGGCTACAGGCCCCAGCGGTAAGCCAGAAGAAGGTAGAGGCCGGTGTCCTTATGACCCGTACCAGAAAAACACTGCCATTACTGTGGATGGAGAACTGTACAGGAACGGTGGCAGACTGCGGGAACTGGCCGTCATTTCGCGACGCGGGCGAGGGCGGCGTGTTGATCGCGCTGACCACTGTATGCAGCGTGAACTGAGCTGGTTCCTGAAGGCTATGTAG

Function

symbol description
sema4ab Predicted to enable chemorepellent activity and semaphorin receptor binding activity. Predicted to be involved in several processes, including generation of neurons; neural crest cell migration; and semaphorin-plexin signaling pathway. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in extracellular space. Predicted to be integral component of plasma membrane. Human ortholog(s) of this gene implicated in cone-rod dystrophy 10 and retinitis pigmentosa 35. Orthologous to human SEMA4A (semaphorin 4A) and SEMA4B (semaphorin 4B).

NR:

description
PREDICTED: semaphorin-4A-like isoform X1

GO:

id name namespace
GO:0007275 multicellular organism development biological_process
GO:0016020 membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043217933.1 True 456 mRNA 0.52 6 5138430 5143254

Neighbor

gene id symbol gene type direction distance location
LOC122323501 LOC107569538,LOC107554410,LOC107703160 coding downstream 49169 5083893 ~ 5089261 (-)
LOC122323498 LOC107550063,LOC107676099,LOC107550192,LOC107672839,LOC107676100 coding downstream 59556 5076714 ~ 5078874 (-)
LOC122323497 LOC107550063,LOC107672839,LOC107676099,LOC107550192,LOC107676100 coding downstream 73260 5063165 ~ 5065170 (-)
LOC122323496 zgc:64022,LOC107672878,LOC107745031,LOC107748382,LOC107563933,LOC107550074,LOC107683352,LOC105906342,LOC108272618 coding downstream 78073 5052326 ~ 5060357 (-)
LOC122323699 chtopa,chtop,LOC107672843,LOC107563917,LOC107698644 coding downstream 310515 4821737 ~ 4827915 (-)
LOC122324190 NA coding upstream 24388 5167642 ~ 5169027 (-)
LOC122323489 NA coding upstream 90527 5233781 ~ 5236532 (-)
si:dkeyp-92c9.4 LOC107756116,LOC107672827,LOC107598229 coding upstream 138189 5281443 ~ 5287161 (-)
txnipa txnipa,txnip,LOC107672857,LOC107702541,LOC107738596,LOC107731569,LOC108410889 coding upstream 167494 5310748 ~ 5314165 (-)
myo1g si:dkeyp-92c9.3,LOC107672858,LOC107702514,LOC107731552,LOC107738593,LOC107571466,LOC107598227 coding upstream 216799 5360053 ~ 5397563 (-)
G130710 syt11a,LOC107745033,LOC107672847,LOC107748350,LOC107676104 non-coding downstream 124740 4873734 ~ 5013690 (-)
G130717 NA non-coding downstream 148667 4850592 ~ 4989763 (-)
G130716 NA non-coding downstream 151464 4849149 ~ 4986966 (-)
G130713 NA non-coding downstream 173601 4830024 ~ 4964829 (-)
G130721 NA non-coding downstream 185158 4951467 ~ 4953272 (-)
LOC122323269 NA non-coding upstream 11 5143265 ~ 5158004 (-)
G130738 NA non-coding upstream 33216 5176470 ~ 5222159 (-)
G130750 NA non-coding upstream 47182 5190436 ~ 5192653 (-)
LOC122323253 NA non-coding upstream 94055 5237309 ~ 5240081 (-)
G130768 NA non-coding upstream 128586 5271840 ~ 5274921 (-)
G130696 NA other downstream 196598 4743572 ~ 4941832 (-)
polr2k NA other downstream 596801 4539979 ~ 4541629 (-)
tmem222b tmem222b,LOC105903612,LOC107550652,LOC107754919,LOC107567586,LOC107700749 other downstream 1586605 3537441 ~ 3551825 (-)
kdf1b LOC107700730,LOC107712602,LOC107550653,LOC107754920,LOC107567594,LOC107689538 other downstream 1623751 3508834 ~ 3514679 (-)
zdhhc18b zdhhc18b,LOC107700701,LOC107737765,LOC107689541,LOC108413341,LOC107550656,LOC107570996 other downstream 1758503 3363481 ~ 3379927 (-)
G130763 NA other upstream 102099 5245353 ~ 5252189 (-)
LOC122324254 NA other upstream 261262 5404516 ~ 5405636 (-)
G131006 LOC107754818,LOC107731580 other upstream 1219093 6362347 ~ 6363172 (-)
sh3bp5lb sh3bp5lb,LOC107711328,LOC107677461,LOC107694325,LOC107754828,LOC107584304,LOC108435520 other upstream 1484344 6627598 ~ 6639220 (-)
polr1h znrd1,LOC107584303,LOC107754832,LOC107677479,LOC107694346,LOC107595594 other upstream 1505136 6648390 ~ 6649389 (-)

Expression


Co-expression Network