G139700 (mep1a.2,LOC105894426,LOC107696095,LOC107601466,LOC107719099,LOC106571460)


Basic Information

Item Value
gene id G139700
gene name mep1a.2,LOC105894426,LOC107696095,LOC107601466,LOC107719099,LOC106571460
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056718.1
NCBI id CM032087.1
chromosome length 27616869
location 18339274 ~ 18339510 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU206339
CACATTCATACATGCGATTCAGTCTTTCCAGATCAAGAGCACTGAAGTCTAAGCGCTGTCCTATTATATTATTGAAGGCAGGGATGGTTGTGGTTATGGTTGGAATATCAGGGTCCTTGTTGAAAGACAGAGGCCTGTAATGCATGATGGACTCGTAATCATAGGGCGTGTTTAAGTCGGTTATCAAATCATCCTCATACTTATTGAAATTGTGTTCCTTTCCTGTGGGTGACATTA

Function

symbol description
mep1a.2 Predicted to enable metalloendopeptidase activity. Acts upstream of or within positive regulation of angiogenesis. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in several structures, including epidermis; gill; heart; liver; and pleuroperitoneal region. Orthologous to human MEP1A (meprin A subunit alpha).

NR:

description
PREDICTED: meprin A subunit alpha-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU206339 True 237 lncRNA 0.41 1 18339274 18339510

Neighbor

gene id symbol gene type direction distance location
pla2g7 pla2g7,LOC107698350,LOC107732404,LOC107553483,LOC107696191,LOC107601536 coding downstream 8222 18325927 ~ 18331052 (-)
fzd3a LOC107732395,LOC107599066,LOC107553488,LOC107719091 coding downstream 108219 18214570 ~ 18231055 (-)
lft1 LOC107732386,LOC107698358,LOC107553491,LOC107719108,LOC107599070,LOC107696102 coding downstream 175949 18161260 ~ 18163325 (-)
kif26bb LOC107732424,LOC107553492,LOC107698359,LOC107719102,LOC107696093,LOC107577345 coding downstream 187601 18134188 ~ 18151673 (-)
cnstb LOC107732406,LOC107698361,LOC107719106,LOC107696101,LOC107553493 coding downstream 206046 18123631 ~ 18133228 (-)
LOC122324297 LOC107683599 coding upstream 14660 18354170 ~ 18363861 (-)
adgrf6 LOC107683600 coding upstream 27257 18366767 ~ 18401190 (-)
LOC122325497 adgrf6,LOC107683600 coding upstream 61656 18401166 ~ 18405819 (-)
LOC122325498 adgrf6,LOC107683600 coding upstream 66293 18405803 ~ 18409109 (-)
LOC122325499 LOC107683600,LOC107601464,LOC107578785 coding upstream 69648 18409158 ~ 18416776 (-)
G139681 NA non-coding downstream 25669 18255858 ~ 18313605 (-)
G139590 NA non-coding downstream 159087 17888568 ~ 18180187 (-)
G139653 NA non-coding downstream 172543 18166126 ~ 18166731 (-)
G139651 LOC107696185,LOC107553490,LOC107698357,LOC107719095 non-coding downstream 181627 18156801 ~ 18157647 (-)
G139591 NA non-coding downstream 231871 18087212 ~ 18107403 (-)
G139701 NA non-coding upstream 519 18340029 ~ 18340244 (-)
G139702 mep1a.2,LOC107601466,LOC107719099,LOC107696095 non-coding upstream 1219 18340729 ~ 18341183 (-)
G139704 NA non-coding upstream 2537 18342047 ~ 18342330 (-)
G139708 adgrf6,LOC107683600 non-coding upstream 66294 18405804 ~ 18411854 (-)
LOC122324299 NA non-coding upstream 110434 18449944 ~ 18452132 (-)
swt1 swt1,LOC107698376,LOC107732364,LOC107696141,LOC107726449 other downstream 515073 17801402 ~ 17824201 (-)
erh erh,ERH,LOC107580641,LOC105904210,LOC100699790,LOC106607637,LOC101174968 other downstream 911151 17346806 ~ 17428123 (-)
G139030 LOC107732636,LOC107693214,LOC107549128,LOC107726455,LOC107601514,LOC107696115 other downstream 1877058 16455468 ~ 16462216 (-)
fndc1 fndc1,LOC107693219,LOC107732645,LOC107549078,LOC107726397,LOC107696111 other downstream 1972475 16347201 ~ 16366799 (-)
LOC122324507 sash1,sash1a,LOC107732642,LOC107601490,LOC107693212,LOC107696119 other downstream 2234547 16017318 ~ 16104727 (-)
adgrf3b LOC107732426,LOC107698325,LOC107553480,LOC107696096,LOC107601465,LOC107719098 other upstream 3953 18343463 ~ 18350122 (-)
G139706 LOC107683600,LOC107601464 other upstream 66517 18406027 ~ 18446949 (-)
batf3 batf3,LOC107558935,LOC107676231,LOC107553434,LOC107727593,LOC107675089 other upstream 915224 19254734 ~ 19256272 (-)
LOC122324949 LOC107676261,LOC107727654,LOC107553459 other upstream 921956 19261466 ~ 19262952 (-)
angel2 LOC107676245,LOC107553457,LOC107727638,LOC107675074,LOC107558950 other upstream 958724 19298234 ~ 19303968 (-)

Expression


Co-expression Network