G140522 (cfap61,LOC107745908,LOC107704077)


Basic Information

Item Value
gene id G140522
gene name cfap61,LOC107745908,LOC107704077
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056718.1
NCBI id CM032087.1
chromosome length 27616869
location 20996366 ~ 20996681 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU207496
CCTTGGATCTTGGCTTGATTATACACTGGAATGAGGTGGTCGTGGTCAGACGGTGGGCAGGCGGGACCCTCCAGGGTCGGGTCACATAAGGGCAGGACAACAGATGCCAAACTCTGCCCCACCTCCTTACAATTAAAGCAGGAGTCGCTCCACTGGTCGGCATGGTAACGACGGGAGTATTTGGTCATGGGGCCTGCGGCGTATATGGAGGGGTCGTTGGTGTGGAAGCTGGTATCTGTGACCAAACGCCCATCGAACACAAGACAGGCATCATTGATGGCCTTGAAGGCATCGTAGTCAACGGTTTTATGAGAGA

Function

symbol description
cfap61 Orthologous to human CFAP61 (cilia and flagella associated protein 61).

NR:

description
PREDICTED: cilia- and flagella-associated protein 61-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU207496 True 316 lncRNA 0.54 1 20996366 20996681

Neighbor

gene id symbol gene type direction distance location
cd109 LOC107704024,LOC107669414,LOC107548408,LOC107559083,LOC107719417 coding downstream 31444 20945637 ~ 20964922 (-)
hmbox1b hmbox1b,LOC107704071,LOC107559131,LOC107669440,LOC107745897 coding downstream 238632 20745202 ~ 20757734 (-)
ints9 ints9 coding downstream 278269 20706925 ~ 20718097 (-)
riox1 zgc:162967,LOC107704066,LOC107669424,LOC107719421,LOC107559126,LOC107548410 coding downstream 315545 20674997 ~ 20680821 (-)
cpsf2 cpsf2,LOC107704064,LOC107669458 coding downstream 323246 20661011 ~ 20673120 (-)
nkx2.4b nkx2.4b,LOC107704036,LOC107548417,LOC107669430,LOC107745907,LOC107580186 coding upstream 83123 21079804 ~ 21082714 (-)
LOC122324706 NA coding upstream 157704 21154385 ~ 21168059 (-)
tram2 tram2,LOC107593275,LOC107721446 coding upstream 254067 21250748 ~ 21256606 (-)
xkr5a xkr5,LOC107721445,LOC107593274,LOC107691011,LOC107719374 coding upstream 262852 21259533 ~ 21264967 (-)
prdm1c NA coding upstream 268734 21265415 ~ 21274238 (-)
LOC122324961 NA non-coding downstream 853 20992521 ~ 20995513 (-)
G140449 NA non-coding downstream 204665 20736588 ~ 20791701 (-)
G140413 NA non-coding downstream 369503 20626655 ~ 20626863 (-)
G140328 NA non-coding downstream 709371 20286480 ~ 20286995 (-)
G140315 NA non-coding downstream 728100 20266668 ~ 20268266 (-)
LOC122325251 NA non-coding upstream 49144 21045825 ~ 21049976 (-)
G140592 NA non-coding upstream 86613 21083294 ~ 21083559 (-)
G140615 NA non-coding upstream 203956 21200637 ~ 21201961 (-)
G140635 NA non-coding upstream 250309 21246990 ~ 21247465 (-)
G140637 NA non-coding upstream 260709 21257390 ~ 21259521 (-)
crnkl1 crnkl1,LOC107548429,LOC107704074,LOC107669451,LOC107559132,LOC106607683,LOC107745910 other downstream 20611 20968188 ~ 20975755 (-)
pkib pkib,LOC107675049,LOC107598105,LOC107602189 other downstream 337986 20634296 ~ 20658380 (-)
nkain2 nkain2,LOC107598078,LOC107675106,LOC107727617,LOC107602191 other downstream 454117 20410629 ~ 20542249 (-)
G140277 cad,LOC107602171 other downstream 933389 20061602 ~ 20062977 (-)
G140227 cad other downstream 936763 20057624 ~ 20059603 (-)
nkx2.2b LOC107704037,LOC107719379,LOC107559088 other upstream 92723 21089404 ~ 21091008 (-)
G140616 NA other upstream 202029 21198710 ~ 21278741 (-)
lin28b lin28b,LOC107721434,LOC107719403,LOC107697090,LOC107550364 other upstream 486911 21483592 ~ 21505655 (-)
LOC122324936 NA other upstream 510563 21507244 ~ 21512483 (-)
batf batf,LOC107697118 other upstream 735863 21732544 ~ 21741077 (-)

Expression


Co-expression Network