G142347



Basic Information


Item Value
gene id G142347
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_056718.1
NCBI id CM032087.1
chromosome length 27616869
location 26319870 ~ 26320141 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence


>TU210345
ataggtcgtaatttagatatatttttaagatggaaaaacgcagttttacagatgctagaaacatgattttcaaaggaaagattgctgtcaaacagcacacctaggttcctaactgatgatgaagaattaacagagcagccatcaagtgatagactgtgttctagattattatatgtggggtttttaggtccaattattagcacctctgttttttcagaatttaacattaagaagttactcataatccagctttttatatcgactatgcattc

Function


GO: NA

KEGG:

id description
ko04138 Autophagy - yeast

RNA


RNA id representative length rna type GC content exon number start site end site
TU210345 True 272 lncRNA 0.33 1 26319870 26320141
Loading

Neighbor


gene id symbol gene type direction distance location
LOC122325330 NA coding downstream 12058 26307401 ~ 26307812 (-)
LOC122325526 LOC107659807,LOC107756058,LOC107567392,LOC107713860,LOC107659806 coding downstream 17995 26299497 ~ 26301875 (-)
LOC122324886 LOC107567392,LOC107713860,LOC107567390,LOC107567391,LOC107756058,LOC107756053 coding downstream 27714 26289769 ~ 26292156 (-)
LOC122324888 NA coding downstream 31623 26287837 ~ 26288247 (-)
LOC122324887 LOC107659807,LOC107756058,LOC107659806,LOC107567392,LOC107737847 coding downstream 32265 26285813 ~ 26287605 (-)
LOC122325425 mdga2,LOC107704381,LOC107556994,LOC108257548,LOC108411484,LOC106571582,LOC106608140 coding upstream 5090 26325231 ~ 26439923 (-)
LOC122325332 wdr20,LOC107730607,LOC107564583,LOC107704379 coding upstream 249626 26569767 ~ 26574013 (-)
trnas-gcu_32 NA coding upstream 294502 26614643 ~ 26614730 (-)
ganaba zgc:171967,LOC107662060,LOC107702959,LOC107722752,LOC107548499,LOC108427707 coding upstream 606092 26926233 ~ 26940284 (-)
her7 LOC107548512,LOC107662101,LOC107740036,LOC107556023,LOC107722746,LOC107702916 coding upstream 627189 26947330 ~ 26948895 (-)
G142346 LOC107737847,LOC107556799,LOC107713860,LOC107756044,LOC107567391 non-coding downstream 8172 26311211 ~ 26311698 (-)
G142299 NA non-coding downstream 49826 26269637 ~ 26270044 (-)
G142297 NA non-coding downstream 51745 26267912 ~ 26268125 (-)
G142280 NA non-coding downstream 88387 26230306 ~ 26231483 (-)
G142282 NA non-coding downstream 127952 26190063 ~ 26191918 (-)
G142349 NA non-coding upstream 43878 26364019 ~ 26381273 (-)
G142354 NA non-coding upstream 152216 26472357 ~ 26472760 (-)
G142355 LOC102197881 non-coding upstream 158410 26478551 ~ 26479196 (-)
G142356 NA non-coding upstream 159161 26479302 ~ 26479785 (-)
G142362 NA non-coding upstream 227047 26547188 ~ 26555553 (-)
G142278 NA other downstream 85625 26232024 ~ 26234245 (-)
G142281 NA other downstream 131951 26185660 ~ 26187919 (-)
pgfa LOC107712199,LOC107704385,LOC107564316,LOC107659813,LOC107575298 other downstream 222899 26088415 ~ 26096971 (-)
LOC122324466 samd15 other downstream 265401 26050829 ~ 26054469 (-)
LOC122324601 slc25a29,LOC107678310,LOC107557018,LOC107728117,LOC107564594,LOC106608124 other downstream 565862 25747667 ~ 25754008 (-)
rps29 NA other upstream 163180 26483321 ~ 26560387 (-)
G142444 slc25a45,LOC107722745,LOC107702892,LOC107662097 other upstream 602674 26922815 ~ 26924987 (-)
LOC122325335 LOC107560343,LOC107662067,LOC107702954,LOC107752242,LOC102202980,LOC101487699,LOC102291410 other upstream 909662 27229803 ~ 27257482 (-)
tex55 LOC107560331,LOC107702887 other upstream 1155953 27476094 ~ 27478227 (-)

Expression


G142347 Expression in all Baseline Samples

Bar chart with 10 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

G142347 Expression in each Bioproject

Bar chart with 2 bars.
G142347 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1750.
End of interactive chart.

Co-expression Network